RNA

Part:BBa_K1210001

Designed by: Zak Stinson   Group: iGEM13_Lethbridge   (2013-08-02)

PK401 Pseudoknot

Pseudoknot from Infectious Bronchitis Virus that induces -1 frameshift during translation. Part has flanking RFC 25 prefix and suffix upstream and downstream.

RFC 25 prefix 5' GAATTCGCGGCCGCTTCTAGATGGCCGGC 3'

RFC 25 suffix 5' ACCGGTTAATACTAGTAGCGGCCGCTGCAG 3'

Assembly with this part should be done using the RFC 25 assembly strategy (which creates the following scar: 5' [part A] ACCGGC [part B] 3'). Assembling using RFC 23 (Silver standard) creates a stop codon in the -1 frame of the scar sequence (5' [part A] ACTAGA [part B] 3'), thus stopping translation in the -1 frame.

This part was characterized using a fluorescent protein test construct (BBa_K1210000), and has been shown to have a frameshifting frequency of 21 ± 5%. This reported frameshifting frequency is in agreement with previously published values (Tholstrup et al., 2011)


Literature Cited

Tholstrup, J., Oddershede, L. B., & Sørensen, M. A. (2011). mRNA pseudoknot structures can act as ribosomal roadblocks. Nucleic acids research, 40(1), 303-313.


Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
Parameters
None