Device

Part:BBa_K1150035

Designed by: Ilona Blank   Group: iGEM13_Freiburg   (2013-09-17)

uniCAS RNAimer to EMX1

RNAimer (EMX1 target)
Function Targeting EMX1 with Cas9
Use in Mammalians
RFC standard RFC 25
Backbone pSB1C3
Submitted by Freiburg 2013

This device derived from BBa_K1150034 can be used in combination with all devices with dCas9. It contains a DNA sequence coding for a crRNA that binds complementary to EMX1 target (GGAAGGGCCTGAGTCCGAGCAGAAGAAGAA).

For more information about dCas9 devices klick here.

Biology and Usage

Freiburg 2013 used this plasmid to test the efficiency of target EMX1 by activating or repressing a SEAP reporter gene.

Sequence and Features

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 224
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 216


[edit]
Categories
Parameters
None