Part:BBa_K1137010
sRNA anti Cm
This complex part contains everything necessary to express small RNA to inhibit expression of the Chloramphenicol resistance cassette cat encoding chloramphenicol acetyltransferase. Very similar to BBa_K1137010, the biobrick contains a Pr promoter, target sRNA, a scaffold derived from MicC lacking the ompC binding sequence, and a T1/TE terminator. The scaffold forms the RNA secondary structure while the target sRNA of the sequence ATATCCAGTGATTTTTTTCTCCAT binds to the target sequence of ATGGAGAAAAAAATCACTGGATAT which includes the start codon and the first 24 bp of the ORF within the chloramphenicol mRNA. It is vital that the sequences are complementary for proper repression to occur. If there are point mutations within a copy of the cat cassette at this location, or a different mechanism provides chloramphenicol resistance the biobrick will not function correctly.
To perform our characterization experiments, we transfrom the plasmid harboring our targeted chloramphenicol resistance gene (pACYCDuet-1) in MG1655 cells expressiong F pili. As in nature resistance are usually located on plasmids our model respect the constraint of having multiple copy of the target gene to silence which would not have been the case with a chromosome located target. The experimental set up consisted of a sequential protocol: In a first step the phage infection leads to the silencing of the antibiotic-resistance genes and in a second step cells are plated on antibiotics to kill them and quantify the efficiency of the silencing. We tested this strategy with different concentrations of chloramphenicol and have shown that the rise of chloramphenicol concentration directly lead to drastic reduction of the survival of the infected cells. We efficiently killed 99,1% of the bacterial population (chloramphenicol concentration 1000ug/ml). We performed the same experiment with a control made of cells infected with a phagemid expressing a non-binding sRNA (actually targeting Kanamycin resistance gene) and have seen no silencing as expected.
We also characterized how the surviving cells acquired the resistance. We can therefore quantify that out of the 1% cells that are surviving at a concentration of 1000ug/ml of Cm, 70% survived by escaping the silencing. If resistance emerge in the target population through mutation of the target sequence it is easy to change the sequence of the silencing sRNA to make it perfectly complementary to the mutated target sequence. Indeed modifying the sequence of the sRNA only require one PCR step with special primers able to introduce the new sequence of choice (step by step protocol for switching sequence of sRNA is described in Yoo et al 2013).
Thanks to the modularity of biobricks it is possible to put several sRNA silencing device next to each others in the same vector. According to Na et al 2013 no burden on E. coli is seen with up to 5 different sRNA introduced in a single strain.
Na D, Yoo SM, Chung H, Park H, Park JH, Lee SY: Metabolic engineering of Escherichia coli using synthetic small regulatory RNAs.
Nature Biotechnology 2013
Yoo SM, Na D, Lee SY: Design and use of synthetic regulatory small RNAs to control gene expression in Escherichia coli Nature Protocols 2013
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 153
Illegal XhoI site found at 159 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |