Plasmid
Part:BBa_I713029
Designed by: Zhenyu Shi Group: iGEM07_Tsinghua (2007-10-26)
pEB-Mob
A clone of Mob gene without stop codon.
Primers:
MobF:
AATTCCATGGCGGCATACGCGATCATGCG
MobR:
AATTGGATCCTGATAATAATGGTTTCTTAGA
Sequence and Features
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 1378
Illegal SpeI site found at 258
Illegal PstI site found at 1338
Illegal PstI site found at 2528 - 12INCOMPATIBLE WITH RFC[12]Illegal SpeI site found at 258
Illegal PstI site found at 1338
Illegal PstI site found at 2528
Illegal NotI site found at 840
Illegal NotI site found at 1359 - 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 2315
Illegal BamHI site found at 252
Illegal BamHI site found at 299
Illegal XhoI site found at 1366 - 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 1378
Illegal SpeI site found at 258
Illegal PstI site found at 1338
Illegal PstI site found at 2528 - 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 1378
Illegal SpeI site found at 258
Illegal PstI site found at 1338
Illegal PstI site found at 2528
Illegal NgoMIV site found at 1704
Illegal NgoMIV site found at 2979 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 520
Illegal BsaI site found at 3878
Illegal SapI.rc site found at 2828
Illegal SapI.rc site found at 3038
[edit]
Categories
Parameters
resistance | AK |