![](https://parts.igem.org/images/partbypart/icon_plasmid.png)
Plasmid
Part:BBa_I713001
Designed by: Zhenyu Shi Group: iGEM07_Tsinghua (2007-10-25)
A pBBR1MCS plasmid without the mob gene.
This plasmid is constructed by PCR with the pBBR1MCS plasmid as template and the following primers:
DMOBF: AATTGCTAGCTGACGTACTCGACCGCCAACACAGC DMOBR: AATAGCTAGCATCCCAAGAGACGGCCCGAGACCTTC
The PCR product was phosphorad and ligated without enzyme digestion, although we did designed an NheI site in the primers.
Since the contruct process contains PCR amplification with Takara LA Taq. The product might have mutations.
The desire sequence should be:
Sequence and Features
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 25
Illegal EcoRI site found at 772
Illegal XbaI site found at 4172
Illegal SpeI site found at 1
Illegal PstI site found at 19 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 25
Illegal EcoRI site found at 772
Illegal NheI site found at 1484
Illegal NheI site found at 1498
Illegal SpeI site found at 1
Illegal PstI site found at 19
Illegal NotI site found at 4164 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 25
Illegal EcoRI site found at 772
Illegal BamHI site found at 7
Illegal XhoI site found at 58 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 25
Illegal EcoRI site found at 772
Illegal XbaI site found at 4172
Illegal SpeI site found at 1
Illegal PstI site found at 19 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 25
Illegal EcoRI site found at 772
Illegal XbaI site found at 4172
Illegal SpeI site found at 1
Illegal PstI site found at 19
Illegal NgoMIV site found at 3525
Illegal AgeI site found at 3685 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 1461
[edit]
Categories
Parameters
None |