Search results (Hint: Try the special 'Search Parts' system on the main page)

Create the page "Assembly standard 65/References" on this wiki! See also the search results found.

• Part:BBa K4165009
  ...ion. For tau's interaction with tubulin and the enhancement of microtubule assembly, normal brain tau appears to require 2-3 moles of phosphate per mole of the ...llary tangles) is inert since it does not bind to tubulin or encourage its assembly into microtubules.
  17 KB (2,394 words) - 22:30, 13 October 2022
• Part:BBa K3151002
  ...We assembled these plasmids via standard BioBrick assembly, and confirmed assembly through restriction digestion and sequence confirmation. <h2>References:</h2>
  10 KB (1,507 words) - 03:42, 22 October 2019
• Part:BBa K3128008
  ...apted into the [http://2018.igem.org/Team:Valencia_UPV/Design Golden Braid assembly method]. Thus, this sequence is both compatible with the BioBrick and Golde ...ion with the [http://2018.igem.org/Team:Valencia_UPV/Protocols Golden Gate assembly protocol].
  42 KB (4,946 words) - 15:00, 1 October 2019
• Part:BBa K3151009
  ...We assembled these plasmids via standard BioBrick assembly, and confirmed assembly through restriction digestion and sequence confirmation. <h2>References:</h2>
  10 KB (1,531 words) - 03:48, 22 October 2019
• Part:BBa K3151011
  ...We assembled these plasmids via standard BioBrick assembly, and confirmed assembly through restriction digestion and sequence confirmation. <h2>References:</h2>
  10 KB (1,548 words) - 03:41, 22 October 2019
• Part:BBa K1150020
  |'''RFC standard''' ...ing this device we used HEK-293T cells, which were seeded at a densitiy of 65,000 cells/well in 24-well plates. After 24 hours RNA plasmids with crRNAs a
  8 KB (1,110 words) - 05:54, 12 October 2016
• Part:BBa K1150019
  |'''RFC standard''' ...ing this device we used HEK-293T cells, which were seeded at a densitiy of 65,000 cells/well in 24-well plates. After 24 hours RNA plasmids with crRNAs a
  7 KB (992 words) - 23:00, 4 October 2013
• Part:BBa K1722012
  |'''RFC standard''' ...uffix after amplification. We constructed the two genes in pSB1C3 using 3A Assembly as described in iGEM.org.
  11 KB (1,752 words) - 15:31, 16 October 2016
• Part:BBa K1722009
  |'''RFC standard''' ...enzyme cutting site and amplify it. Then assemble the three parts using 3A Assembly Method.
  5 KB (820 words) - 14:21, 17 September 2015
• Part:BBa K1722011
  |'''RFC standard''' ...primers and amplified the gene sequences from psi-Check2 vector. Using 3A Assembly method, we constructed hTERT and tRNA in pSB1C3.
  7 KB (1,160 words) - 14:22, 17 September 2015
• Part:BBa K1722013
  |'''RFC standard''' ...uffix after amplification. We constructed the two genes in pSB1C3 using 3A Assembly as described in iGEM.org.
  11 KB (1,744 words) - 14:23, 17 September 2015
• Part:BBa K4665170
  ...sDNA molecule, referred to as a scaffold, which acts as a backbone for the assembly of defined DNA nanostructures. The ssDNA scaffold will be folded into the d ...rn et al. (2022). First, the dsDNA scaffold sequence was amplified using a standard primer (5' GGGATTCATGGTGTATTGCTTCACC 3') in combination with a modified pri
  26 KB (2,931 words) - 22:08, 11 October 2023
• Part:BBa K404108
  |'''RFC standard''' assembly and genome encapsidation (pRC and pHelper) in a molar ratio of
  7 KB (1,018 words) - 19:59, 16 October 2019
• Part:BBa K1390019
  ...o be expressed correctly. Furthermore, the activity assay suggests correct assembly of the subunits. ...d with a calibration curve as a function of time. The error bars represent standard error (n=3).]]
  13 KB (1,961 words) - 14:32, 12 October 2023
• Part:BBa K1438025
  ...se chain reaction (PCR) for amplification of single light and heavy chain. Assembly PCR for combination of amplified light and heavy chain containing GS-Linker References:
  4 KB (521 words) - 23:14, 17 October 2014