Difference between revisions of "Recombination/Bacteriophage lambda-derived att"

Latest revision as of 13:00, 1 June 2009

< Back to Recombination systems, DNA recombination sites, or Recombinases

The 2004 Boston University iGEM team designed and constructed the att recombination sites BBa_I11022 and BBa_I11023.

The following is excerpted from Radman-Livaja et al. RadmanLivaja and Landy et al. Landy. It has been edited for clarity.

Bacteriophage λ has long served as a model system for studies of regulated site-specific recombination. In conditions favorable for bacterial growth, the phage genome is inserted into the Escherichia coli genome by an ‘integrative’ recombination reaction, which takes place between DNA attachment sites called attP and attB in the phage and bacterial genomes, respectively. As a result, the integrated λ DNA is bounded by hybrid attachment sites, termed attL and attR. In response to the physiological state of the bacterial host or to DNA damage, λ phage DNA excises itself from the host chromosome. This excision reaction recombines attL with attR to precisely restore the attP and attB sites on the circular λ and E. coli DNAs Campbell. The phage-encoded λ integrase protein (Int), a tyrosine recombinase, splices together bacterial and phage attachment sites. Int is required for both integration and excision of the λ prophage Zissler67.

λ recombination has a strong directional bias in response to environmental conditions. Accessory factors, whose expression levels change in response to host physiology, control the action of Int and determine whether the phage genome will remain integrated or be excised. Int has two DNA-binding domains: a C-terminal domain, consisting of a catalytic domain and a core-binding (CB) domain, that interacts with the core recombining sites and an N-terminal domain (N-domain) that recognizes the regulatory arm DNA sites Wojciak02. The heterobivalent Int molecules bridge distant core and arm sites with the help of accessory proteins, such as integration host factor (IHF), which bend the DNA at intervening sites, and appose arm and core sequences for interaction with the Int recombinase. Five arm DNA sites in the regions flanking the core of attP are differentially occupied during integration and excision reactions. The integration products attL and attR cannot revert back to attP and attB without assistance from the phage-encoded factor Xis, which bends DNA on its own or in combination with the host-encoded factor Fis Abremski82,Abremski81,Hoess80,Thompson87a,Thompson87b,Ball91. Xis also inhibits integration, and prevents the attP and attB products of excision from reverting to attL and attR Abremski81,18]. Excision is inhibited by high concentrations of IHF <cite>Bushman85,Thompson86. Because the cellular levels of IHF and Fis proteins respond to growth conditions, these host-encoded factors have been proposed as the master signals for integration and excision Thompson87a,Bushman85,Thompson86, Nilsson92,Ball92, Ball91.

The phage (attP) and bacterial (attB) att sites are designated POP’ and BOB’, respectively, and the prophage att sites are designated BOP’ (attL) and POB’ (attR).

Recombination sites

*More...*
Name	Description	Sequence	Length
BBa_I11022	Lambda attB, reverse complement	accactttgtacaagaaagctgggt	25
BBa_I11023	Lambda attP	. . . tcactatcagtcaaaataaaatcattattt	232
BBa_K112141	attR2 recombination site	. . . gttcagctttcttgtacaaagtggttgatc	136
BBa_K112142	attR2 recombination site-reverse orientation	. . . aacacaacatatccagtcactatggtcgac	136

Recombinases

*More...*
Name	Protein	Description	Direction	KEGG	UniProt	E.C.	Length
BBa_I11021	Xis lambda	excisionase from E. coli phage lambda (removes prophage from host genome)	Forward	none	P03699	none	280
BBa_I11020	Int lambda	integrase from E. coli phage lambda	Forward	none	P03700	none	1132
BBa_K112001	Xis	Xis from bacteriophage lambda, assembly standard 21					216
BBa_K112204		{a~xis!} The bacteriophage lambda xis gene ready to have rbs attached and stop codon; assembly stand					223
BBa_K112200		{xis!} from bacteriophage lambda; assembly standard 21					219

Composite parts

*More...*
Name	Type	Description	Length	Status
BBa_K112137	Composite	Xis Int & TrfA combined expression cassette	2712	It's complicated
BBa_K112132	Composite	Xis Int controlled by temperature sensitive	2169	It's complicated
BBa_K112133	Composite	Xis Int temperature sensitive expression cassette	2215	It's complicated
BBa_K112327	Protein_Domain	{rbs_pelB>} {< xis>}	304	Not in stock

References

Campbell Campbell, AM. Episomes. In: Caspari EW, Thoday JM. , editors. Advances in Genetics. 1. New York: Academic Press; 1962. pp. 101–145.
Zissler67 pmid=5637199
Guameros70 pmid=4907272
Kaiser70 pmid=4907271
Echols70 pmid=4907273
Shimada72 pmid=4552408
Shimada75 pmid=1095763
Fiandt72 pmid=4567155
Hirsch72 pmid=4567154
Hoess80 pmid=6446713
Abremski81 pmid=6279866
Abremski82 pmid=6213611
Bushman85 pmid=2932798
Thompson86 pmid=2946666
Thompson87a pmid=2957063
Thompson87b pmid=2958633
Kitts88a pmid=2970060
Kitts88b pmid=2975338
NunesDuby87 pmid=3040260
Holliday64 Holliday, R. A mechanism for gene conversion in fungi. Genet Res. 1964;5:282–304.
Ball91 pmid=1829453
Ball92 pmid=1459953
Nilsson92 pmid=1732224
Hallett97 pmid=9348666
Azaro02 Azaro, MA; Landy, A. λ Int and the λ Int family. In: Craig NL, Craigie R, Gellert M, Lambowitz A. , editors. Mobile DNA II. Washington, DC: ASM Press; 2002. pp. 118–148.
Wojciak02 pmid=11904406
Landy pmid=331474
Landy89 pmid=2528323
RadmanLivaja pmid=16368232

</biblio>

@@ Line 33: / Line 33: @@
 <!-- To include a part in this table, include the categories "//function/recombination/lambda" and set the part type to Coding under the Hard Information tab of the part. -->
+===Composite parts===
+<parttable>lambda_recombination_composite_parts </parttable>
+<!-- To include a part in this table, include the categories "//function/recombination/lambda" of a composite part under the Hard Information tab of the part. -->
 ===References===