Part:BBa_K2216001
The coding sequence codes for Aldehyde dehydrogenase A(aldA), which is responsible for the reaction:
Aldehyde + NADP(+) + H2O to Carboxylic Acid + NADPH + 2H(+)
In our project specifically, the protein completes the degradation of malondialdehyde(MDA ) to carboxylate Malonic Semialdehyde(3-oxopropanoic acid). MDA is the end-product generated by lipid peroxidation, a process under which oxidants attack lipids containing carbon double bonds, especially polyunsaturated fatty acids (PUFAs) and the most mutagenic product of lipid peroxidation(Ayala et.al). Apart from endogenous source, we acquire lipids via food and cooking oils in our diets. The quality and quantity of lipids in our dietary source of lipid, therefore, influence the blood lipid parameters in body, which is why high contents of peroxidation products like MDA are hazardous and related to several pathological processes including cancer, diabetes, liver diseases, and cardiovascular diseases(Peroumal and Koner; Ayala et.al). MDA could react with cellular and tissular proteins or DNA to form adducts that results in damages(Ayala et.al). Heating increases the level of MDA significantly in cooking oil(Peroumal and Koner). Repeated heating and reusing of oil create unsafe oil products with high contents in MDA. MDA degradation pathway is shown in the research paper “Lipid Peroxidation: Production, Metabolism, and Signaling Mechanisms of Malondialdehyde and 4-Hydroxy-2-Nonenal”. The gene comes from Escherichia coli KO11FL.
The primer for making the part from PCR is: Forward Primer 5’ 3’ Prefix -- matching primer (coding region) (st.codon) 5’ GTTTCTTC GAATTC GCGGCCGC T TCTAG -- ATG TCAGTACCCGTTCAACATCCT 3’
Reverse primer 3’ 5’ Suffix (reverse compliment) -- matching primer coding region (reverse compliment) 3’ T ACTAGT A GCGGCCG CTGCAG GAAGAAAC – TTAATATTCACGCGATATGTTGGTT 5’
Citation:
A. Ayala, M.F. Munoz, and S. Arguelles. “Lipid Peroxidation: Production, Metabolism, and Signaling Mechanisms of Malondialdehyde and 4-Hydroxy-2-Nonenal,”Oxidative Medicine and Cellular Longevity, vol.2014, article ID 360438, 8 May 2014.
D. Peroumal and B.C. Koner. “Effect of different cooking vessels on heat induced lipid peroxidation of different edible oils” Journal of Food Biochemistry. 32(6):pp740-751. November 2008.
| protein |