Difference between revisions of "Part:BBa K2040122"

Revision as of 04:59, 22 October 2016

KillerRed + NLS

A SV40 nuclear localization signal(NLS) was fused to the phototoxic protein KillerRed.

Usage and Biology

KillerRed(BBa_K1184000) is a red fluorescent protein that produces reactive oxygen species (ROS) in the presence of yellow-orange light (540-585 nm). It is engineered from anm2CP to be phototoxic. Expression of KillerRed and irradiation with light may act a kill-switch for biosafety applications. More details about KillerRed see [http://2013.igem.org/Team:Carnegie_Mellon/KillerRed 2013 Carnegie_Mellon].

KillerRed effectively killed bacterial cells when exposed to white light for several minutes. However, in eukaryotic cells, irradiation of KillerRed localized in cell cytosol has a weak effect on cell survival^[2]. The following two ways have been found to be effective for killing the eukaryotic cells using KillerRed: (1) via an apoptotic pathway using KillerRed targeted to mitochondria, and (2) via membrane lipid oxidation using membrane-localized KillerRed. ^[2]

Chromatin is also a ROS-sensitive intracellular localization.So we designed to fuse a SV40 nuclear localization signal to KillerRed protein in order to increase efficiency of KillerRed-mediated oxidative stress.

So we tried to fused a SV40 nuclear localization signal(5' CCTCCCAAGAAGAAGCGCAAGGTC 3') to the KillerRed protein in order to let it locate in the nucleus where the chromatin locates.

References

[1]2013 Carnegie_Mellon ;http://2013.igem.org/Team:Carnegie_Mellon/KillerRed

[2]Genetically-encoded photosensitizer KillerRed; http://evrogen.com/products/KillerRed/KillerRed_Detailed_description.shtml

Sequence and Features