Part:BBa_K2040100:Experience
Applications of BBa_K2040100
We used forward primer 5' ACGTCCTGCAGAATCATGCAGCGCTATGAG 3' & reverse primer 5' ATAAGCGGCCGCCATGATGGTCTAGGGAACG 3' to extract PMcl1 and its 5' untranslated region (99bp downstream the promoter) from genomic DNA of Metarhizium anisopliae. The whole length is 2772bp.
Then we digested the DNA fragment with NotI and PstI in order to insert it into the backbone. However, when we ran gel electrophoresis to check the digestion result, we found that there is still one PstI restriction site inside the PMcl1 whcih is the one we did not know when we designed.
We decided to sequence this DNA fragment we extracted and mutate the PstI site, but we didn't have enough time to finish our relative vectors construction.
User Reviews
UNIQacc009b32c63db42-partinfo-00000000-QINU UNIQacc009b32c63db42-partinfo-00000001-QINU