Part:BBa_K4811008
TMS(Neo1)
This is a tRNA Mimicking Structure (TMS). It is a novel piece of synthetically designed RNA, which folds in the same manner as tRNA, developed by Paul et al. It is a trans-encoded genetic switch, which binds to the Ribosome Binding Site (RBS) BBa_K4811000, repressing translation. The binding regions are flanking the RBS, and no binding happens in the RBS consensus sequence. This means that there are very few limitations on both the possible TMSs and repressible RBSs which could be engineered.
In this particular part, the D-loop of BBa_K4811002 has been exchanged for a Neomycin-sensitive aptamer, which has the sequence GGACTGGGCGAGAAGTTTAGTCC
The Neomycin aptamer is from Jiang et al (see Design).
Figure 1. Prediction of folding of the RNA using ViennaRNA. The figure is colored by base-pairing probabilities. For paired regions, the color denotes the probability of being paired. For unpaired regions, the color denotes the probability of being unpaired. Using the following parameters: minimum free energy (MFE) and partition function, avoid isolated base pairs, Incorporate G–Quadruplex formation into the structure prediction algorithm, dangling energies on both sides of a helix in any case, RNA parameters (Andronescu model, 2007) Lorenz, R. and Bernhart, S.H. and Höner zu Siederdissen, C. and Tafer, H. and Flamm, C. and Stadler, P.F. and Hofacker, I.L. "ViennaRNA Package 2.0", Algorithms for Molecular Biology, 6:1 page(s): 26, 2011.
Characterization
The part was tested as the composite part BBa_K4811018 in E. coli BL21(DE3), where the TMS is induced by IPTG. This construct was USER cloned into the high copy number pUC19 backbone for testing. A reporter, consisting of BBa_K4811003 was USER cloned into the low copy number pACYC184 backbone. This has mCherry, under control of the pBAD promoter, meaning L-arabinose will induce mCherry transcription. The mCherry transcript has the RBS BBa_K4811000 incorporated, meaning that translation of mCherry should be inhibited by the TMS, if the inhibiting capabilities are conserved upon changing the D-loop.
A general schematic of the system to be tested can be seen below:
Figure 2. mCherry is induced by L-ara, and the TMS is induced by IPTG. The hypothesis is, that the TMS is able to repress translation of mCherry, by binding to the RBS, and that a ligand, in this case neomycinB-azide is able to bind to the TMS, releasing the mCherry RBS of the TMS, allowing translation to begin.
A. Paul, who created the system during their PhD, got the following results:
Figure 3. Controlling gene expression by the NeoB-TMS-IBE (BBa_K4811008) and GFP-TMS-IBE (BBa_K4811006) switches (1). Binding of the switches prevents ribosome binding (2), which is reversed by binding of the corresponding aptamer ligand (3). The GFP-TMS-IBE switch controls mCherry expression. b) Titration of azide-conjugated neomycin B leads to increased GFP production. c) Inducing GFP expression with anhydrotetracycline leads to increasing mCherry fluorescence.
These results showed a clear repression of mCherry translation by the TMS(Neo1), as well as NeomycinB-azide interfering with this control, with NeomycinB-azide leading to higher mCherry fluorescence. Since we couldn't acquire neomycinB-azide, we couldn't recreate these results.
We could have tested the system in a neomycin resistant strain, using neomycin as the ligand, but the most common resistance mechanisms alter the structure of neomycin, and therefore we chose to invest our time elsewhere.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 71
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |