Part:BBa_K4811006
TMS(GFP1)
This is a tRNA Mimicking Structure (TMS). It is a novel piece of synthetically designed RNA, which folds in the same manner as tRNA, developed by Paul et al. It is a trans-encoded genetic switch, which binds to the Ribosome Binding Site (RBS) BBa_K4811001, repressing translation. The binding regions are flanking the RBS, and no binding happens in the RBS consensus sequence. This means that there are very few limitations on both the possible TMSs and repressible RBSs which could be engineered.
In this particular part, the D-loop of BBa_K4811002 has been exchanged for a GFP-sensitive aptamer, with the sequence: GGACAGATCTGGGAGCACGATGGCGTGGCGAATTGGGTGGGGAAAGTCCTTAAAAGAGGGCCACCACAGAAGCAATGGGCTTCTGGACTCGGTAGATCTGTCC
The aptamer was from Shui et al (see Design).
Figure 1. Prediction of folding of the RNA using ViennaRNA. The figure is colored by base-pairing probabilities. For paired regions, the color denotes the probability of being paired. For unpaired regions, the color denotes the probability of being unpaired. Using the following parameters: minimum free energy (MFE) and partition function, avoid isolated base pairs, Incorporate G–Quadruplex formation into the structure prediction algorithm, dangling energies on both sides of a helix in any case, RNA parameters (Andronescu model, 2007)
Lorenz, R. and Bernhart, S.H. and Höner zu Siederdissen, C. and Tafer, H. and Flamm, C. and Stadler, P.F. and Hofacker, I.L. "ViennaRNA Package 2.0", Algorithms for Molecular Biology, 6:1 page(s): 26, 2011.
Characterization
The part was tested as the composite part BBa_K4811018 in E. coli BL21(DE3), where the TMS is induced by IPTG. This construct was USER cloned into the high copy number pUC19 backbone for testing. A reporter, consisting of BBa_K4811005 was USER cloned into the low copy number pACYC184 backbone. This has GFP under control of Ptet promoter, and therefore induced by aTc. It also has mCherry, under control of the pBAD promoter, meaning L-arabinose will induce mCherry transcription. The mCherry transcript has the RBS BBa_K4811000 incorporated, meaning that translation of mCherry should be inhibited by the TMS, if the inhibiting capabilities are conserved upon changing the D-loop.
A general schematic of the system to be tested can be seen below:
Figure 2. GFP is induced by aTc, mCherry is induced by L-ara, and the TMS is induced by IPTG. The hypothesis is, that the TMS is able to repress translation of mCherry, by binding to the RBS, and that GFP is able to bind to the TMS, releasing the mCherry RBS of the TMS, allowing translation to begin.
A. Paul, who created the system during their PhD, got the following results:
Figure 3. Controlling gene expression by the NeoB-TMS-IBE (BBa_K4811008) and GFP-TMS-IBE (BBa_K4811006) switches (1). Binding of the switches prevents ribosome binding (2), which is reversed by binding of the corresponding aptamer ligand (3). The GFP-TMS-IBE switch controls mCherry expression. b) Titration of azide-conjugated neomycin B leads to increased GFP production. c) Inducing GFP expression with anhydrotetracycline leads to increasing mCherry fluorescence. From "Modular and Versatile Trans-Encoded Genetic Switches", A. Paul, E. M. Warszawik, M. Loznik, A. J. Boersma, A. Herrmann, Angew. Chem. Int. Ed. 2020, 59, 20328.
Validation of existing data from A. Paul
We tried to recreate these results, see BBa_K4811006, but were unable to see the same mCherry control by GFP. We did not have access to neomycinB-azide, so were unable to test the TMS(Neo). The following graphs show the results of the TMS(GFP):
Figure 7. OD normalized relative GFP fluorescence, 488 nm excitation/545 nm emission, as a function of anhydrotetracycline (aTc) concentration. All measurements were with 1 mM IPTG and 0.1 % w/v L-arabinose, except the controls. As controls there is a culture induced with 1 mM IPTG only (IPTG), one induced by L-arabinose only (L-ara), and one with no inducers present (uninduced)
Figure 8. OD normalized relative mCherry fluorescence, 561 nm excitation/617 nm emission, as a function of anhydrotetracycline (aTc) concentration. All measurements were with 1 mM IPTG and 0.1 % w/v L-arabinose, except the controls. As controls there is a culture induced with only 1 mM IPTG (IPTG), one only induced by L-arabinose (L-ara), and one with no inducers present (uninduced)
The results clearly showed that aTc induced GFP, with 0.5 uM having the highest fluorescence. We would have expected 1 uM GFP to have even higher fluorescence, however it seems to be lower, but with a much higher standard deviation associated with the data.
When looking at the corresponding mCherry fluorescence, there seems to be no significant difference when varying the amount of aTc. Therefore, we were not able to recreate the results of A. Pual, where GFP led to an increase in mCherry fluorescence. However, comparing the L-ara control with 0 uM aTc, where there is 1 mM IPTG and 0.1 % w/v L-arabinose, there is no significant difference between the mCherry fluorescence between these two measurements. This leads us to believe that possibly the TMS ability to inhibit mCherry was somehow altered in this experimental setup.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 16
Illegal BglII site found at 105
Illegal XhoI site found at 114
Illegal XhoI site found at 150 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
| None |