Part:BBa_K4706000

pSB1C30YIpHR-HO Chromosomal integration at HO loci

pSB1C30YIpHR-HO is based of pSB1C30, it houses the HO locus homology sequences from ScHR3p-HO BBa_J435241 and ScHR5p-HO BBa_J435242 to facilitate stable genome integration adjacent to S. cerevisiae HO locus.

The Primers needed to linearise the vector for S. cerevisiae insertion are:

fwd: tctaattgtatcgagatcacttttcgtgatccg rev: GGCAGAACTAACTCTTTATTTTTCCAAATCAGAAAA

Usage and Biology

Yeast Integrating plasmids (YIp) are non autonomously replicating plasmids that do not contain an ORI or similar replication modes like CEN/ARS containing plasmids that transform the DNA by homologous recombination. Once integrated into the genome those strains are usually relatively stable.

8 * 50ul PCR reactions with about 1-5ng of template and 30 cycles will result, if no Primer binding occurs at the insert of the vector, (after PCR cleanup in the same(!) spin column) for more then enough DNA for multiple S. cerevisae transformations. (Remember to use a Polymerase that leaves blunt ends)

We would recommend the following modifications for future Teams/Users: 1. If possible introduce Blunt end cutting sites at the ends of the Homology regions, that way you can use digested Plasmid from a minipred/mediprep of ecoli which would result in more product

Characterisation by team Duesseldorf 2023:

28 random colonies were screened, 4 colonies without any insertion present:

At first glance it seems like the colony PCRs results in mostly background noise which results in the insert bands being barely visible (we expected an amplicon of 1kb), another posibility we thought about is unspecific amplification of our insert we introduced. This would better also better explain why we still had 4 colonies without any amplification.

As a reference, we conducted a screening of 28 colonies of the "Wild type" strain BY4741. We employed the identical protocol used for our own colonies and the insertion test described earlier. It's worth noting that the primer binding and subsequent amplification may appear unspecific, as we didn't observe any amplification in our unmodified BY4741. This proves that in contrast to our unspecific bands, we do not have regions where the primers can efficiently bind in the “Wild type”. .Based on this, we can confidently affirm the functionality of our plasmid backbone. This backbone, after linearization, can be effectively introduced into S. cerevisiae through transformation.

This result does suggest that our linear DNA which was amplified from our backbone has a suprsingly high transfromation frequency. Out of 28 screened colonies we only observed four(4) colonies that tested negative on the instert. This would result in an aproximate transformation frequency of 85.7%. We would have loved to conduct additional tests but due to time and ressource constraints we were not able to do so.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  INCOMPATIBLE WITH RFC[12]

  Plasmid lacks a prefix.
  Plasmid lacks a suffix.
  Illegal EcoRI site found at 3049
  Illegal SpeI site found at 2
  Illegal PstI site found at 16
  Illegal NotI site found at 9
  Illegal NotI site found at 3055
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Plasmid lacks a prefix.
  Plasmid lacks a suffix.
  Illegal EcoRI site found at 3049
  Illegal BglII site found at 2500
  Illegal XhoI site found at 1533
  Illegal XhoI site found at 2425
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal prefix found at 3049
  Illegal suffix found at 2
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal prefix found at 3049
  Plasmid lacks a suffix.
  Illegal XbaI site found at 3064
  Illegal SpeI site found at 2
  Illegal PstI site found at 16
  
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Plasmid lacks a prefix.
  Plasmid lacks a suffix.
  

References: 1. Parent, S.A., Fenimore, C.M. and Bostian, K.A. (1985), Vector systems for the expression, analysis and cloning of DNA sequence in S. cerevisiae. Yeast, 1: 83-138. https://doi.org/10.1002/yea.320010202 2. Hinnen, A., Hicks, J. B. and Fink, G. R. (1978). Transformation of yeast. Proceedings of the National Academy of Sciences U.S.A.75,1929]