Part:BBa_K4608003

Empty guide RNA scaffold for Cas7-11

Sequence containing the constant region of the Cas7-11 guide RNA, as well as an empty spacer sequence where custom guide RNAs can be cloned in through BsaI Golden Gate. Can be used for gRNA expression in any organism (yeast, bacteria, mammalian), downstream of a polymerase III-recruiting promoter such as U6 in mammalian, or SNR52 in yeast.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  COMPATIBLE WITH RFC[21]
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Having designed eight distinct fusion proteins for our Proteus system and chosen an endonuclease-catalytically dead version of Cas7-11 for activation of Csx29, our iGEM team’s last Craspase design consideration came down to the guide RNA (gRNA). The gRNA consists of two continuous sections: a constant region and a spacer region (Strecker, 2022). The constant region of the gRNA is on the 5’ end, and is not changed. It allows Cas7-11 to recognize and bind the gRNA, akin to a “handle”. The constant region is followed by the 31bp spacer region that is customised to be complementary to the target RNA so as to bind to it.

Figure 1 | Schematic depicting gRNA binding to its target RNA - illustration is from Strecker et al., Science 2022 (https://www.science.org/doi/10.1126/science.add7450), full credit goes to the authors.

The guide RNA binds to its target RNA in an antiparallel complementary fashion, where the 5’ end of the target RNA is in the same direction as the 3’ end of the guide RNA. Therefore, when one designs the guide RNA, the spacer sequence from 5’ to 3’ will be the reverse complement of the target RNA region that one would want to target.

For example, given this target RNA, with the bolded and underlined 31bp region being the sequence we would like the gRNA to bind to, we would take the reverse complement of the sequence and have that as our spacer sequence from 5’ to 3’. The reverse complement, and thus our spacer sequence is: 5’ - CCAAGTCTGCCTGGTTGCAAATCTTGCAGCG - 3’. If we anneal this back to our target RNA, we get the following:

Inevitably, a question that comes up immediately when targeting mutations, in particular point mutations, with CRISPR is the specificity of the system. Is one mismatch between KRAS WT and the gRNA (which is fully complementary to KRAS G12D) sufficient to not activate Craspase in healthy cells? There have been long standing concerns of off-target effects with CRISPR Cas9, especially in vivo, so off-target effects with the Craspase system was a significant consideration for us. Fortunately, the Craspase paper upon which we are basing our system off of tested Craspase’s tolerance to mismatches in the gRNA-target RNA duplex. While they didn’t test single point mismatches, they tested the effect of two adjacent mismatches in the first 22bp (from the 5’ end) of the gRNA spacer region (Strecker, 2022).

Figure from Strecker et al., Science 2022 (full credit for figure goes to authors) showing the tolerance of the Craspase system to two adjacent mismatches between the target RNA and gRNA. Blotted is the size of Csx30, where the size at ~64 kDa indicates full length Csx30 whereas the lines at ~48 and 16 kDa indicate the cleaved Csx30.

As can be seen in the figure taken from the supplementary methods of the paper, two adjacent mismatches in positions (1,2), (3,4), (7,8), (9,10), (11,12) still caused the Craspase system to cleave Csx30 (smaller bands on the western blot indicate cleaved fragments of Csx30). Notably however, no two adjacent mismatches in positions 13 onwards until 22 caused no activation of Craspase.

Nucleotides on the gRNA coloured red tolerate two adjacent mismatches (i.e. two mismatches between gRNA and target still activate Craspase), whereas those in green do not. Residue number landmarks are indicated below the gRNA. Therefore, to ensure that when targeting the KRAS(G12D) mutation, our gRNA has the lowest chance of activating the Craspase system when binding to KRAS WT, we decided to position residue #18 of the gRNA (which is right in the middle of the part of the gRNA where no two adjacent mutations are tolerated) at the nucleotide where KRAS G12D and KRAS WT differ.

Note how the 18th residue of the gRNA (a U) matches perfectly with the G12D KRAS transcript (binds an A), but binds a G (thus a mismatch) in the WT gRNA. We hope that one mismatch in this region is sufficient to prevent activation of the Craspase system to the KRAS WT transcript. If one mismatch is not sufficient, we can explore the possibility of “pre-installing” a mismatch adjacent to residue #18 (likely residue #17), such that there is one mismatch between the gRNA and KRAS G12D (which would still activate Craspase), but two adjacent mismatches in the case of KRAS WT - which we know from Strecker et al., 2022 would not activate Craspase.

When we tested out our KRAS WT-targeting guide RNA (as this is the guide RNA we successfully managed to clone and test before wiki freeze) against KRAS G12D (with one mismatch) and KRAS WT (perfect complementarity), we observed that the perfect matching gRNA was able to activate the Craspase system and trigger cell death in some of our fusion protein designs. However, when using the guide RNA with one mismatch, it seems like the Craspase system was unable to be activated, suggesting that even one mismatch at position 18 in the gRNA between the gRNA and the target RNA is sufficient to prevent activation of the Craspase system.

Replicate 1 of microscopy results, using a fully complimentary gRNA to the target RNA that should activate the Craspase system.

Replicate 1 of microscopy results, using a gRNA that contains one mismatch to the target RNA that should theoretically not activate the Craspase system.

Replicate 2 of microscopy results, using a fully complimentary gRNA to the target RNA that should activate the Craspase system.

Replicate 2 of microscopy results, using a gRNA that contains one mismatch to the target RNA that should theoretically not activate the Craspase system.

Of note, our team plans on doing many more replicates of this experiment and also directly observing Csx30 cleavage with the perfectly matching and one-mismatch gRNA to confirm this observation.

References

Strecker, J., Demircioglu, F. E., Li, D., Faure, G., Wilkinson, M. E., Gootenberg, J. S., ... & Zhang, F. (2022). RNA-activated protein cleavage with a CRISPR-associated endopeptidase. Science, 378(6622), 874-881.