RNA

Part:BBa_K1723018

Designed by: Cyril Pulver   Group: iGEM15_EPFL   (2015-09-16)

c7_1 gRNA expressing sequence

The c7_1 guide RNA (gRNA) consists of the 20 base pair specificity determinant sequence (SDS) c7_1 (GCTGTGTGTTACGAGGCCAT) followed by a gRNA scaffold that stabilizes the RNA complex. The gRNA is flanked by two self-cleaving ribozymes: a Hammerhead Ribozyme and a Hepatitis Delta Virus (HDV) Ribozyme thus freeing the gRNA from the rest of the RNA transcript, and making it possible to produce the gRNA using RNA Polymerase II [1]. Then, the gRNA can form a complex with dCas9-VP64 (BBa_K1723021) (or theoretically other Cas9 mutants). The complex c7_1-dCas9_VP64 will bind specifically to GCTGTGTGTTACGAGGCCAT sequences in the genome of the host organism situated directly before a PAM sequence (NGG). Binding of the complex on the c7_1 sequence of promoter CYC_1 (BBa_K1723023) will result in inhibiting CYC_1 via steric hindering of the RNA polymerase II binding site by dCas9_VP64. A similar mechanism has been proven to work with gRNA c7_0 (produced by BBa_K1723017) and promoter CYC_0 (BBa_K1723022) [2].

To learn more about how this part was used specific to our project, please follow this link: http://2015.igem.org/Team:EPF_Lausanne/Part_Collection

Usage and Biology

S. cerevisiae

[edit]
Categories
Parameters
None