Part:BBa_K5044310
pQQC7
Contents
- 1 Plastid transformation vector for kiwifruit（pQQC7）.
- 2 Plastid transformation
- 3 RESULTS
- 3.1 Construction of kiwifruit plastid transformation vector
- 3.2 Production and analyses of transplastomic kiwifruit plants
- 3.3 Determination of GFP expression levels in transplastomic plants
- 3.4 Subcellular localization of GFP in transplastomic plants
- 3.5 Detection of GFP fluorescence signal
- 3.6 Adaptations to the original sequence were made for assembly compatibility
rrnB terminator from Escherichia coli
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NotI site found at 881
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 2089
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 2326
Illegal BsaI.rc site found at 807
Plastid transformation vector for kiwifruit（pQQC7）.
Plastid transformation
Transformation of plastid (chloroplast) genome offers multiple advantages over conventional nuclear transformation, including potential of extremely high levels of transgene expression [1, 2], accommodation of transgene into the plastid genome through homologous recombination without position effects (Figure 1) [3], and the possibility of stacking multiple transgenes in synthetic operons [4, 5]. Successful plastid transformation was firstly established in a unicellular alga Chlamydomonas reindhartii [6], and two years later in a seed plant tobacco [7]. Over the past 30 years, transplastoimc technology was further extended in more than 20 seed plants [8]. However, major crops, such as rice, wheat and maize, were missing in the transformable list, and poplar was the only woody species.
Figure 1. Targeting of a gene of interest (GOI) to a neutral insertion site in the plastid genome. Integration of GOI and selectable marker gene (SMG) cassettes into the plastid genome occurs through homologous recombination. A typical cassette comprises a promoter (green boxes), 5′ untranslated region (UTR, white boxes), coding region, and 3′ UTR (red boxes). Possible recombination events leading to successful plastid transformation are indicated by dashed arrows.
Kiwifruit, belonging to the genus Actinidia that originated in China, comprises approximately 54 species [9]. It is well known as the “king of fruits”, owing to its extremely high content of vitamin C, nutritional minerals, and diverse metabolites that are beneficial for human healthy [10]. Unlike most other plants, in which the plastid genome is maternally inherited, the kiwifruit exhibits a complex system of plastid inheritance with possible transmission through both maternal and paternal lines [11]. Development of kiwifruit plastid transformation is still attractive for efficient production of edible vaccines, biopharmaceuticals, and antibodies, due to the high-level accumulation of recombinant protein that can be generally achieved in transplastomic plants (up to 75% of the total soluble protein (TSP)) [2]. In addition, the plastid-transformed kiwifruit plants would provide a useful tool to study the complex inheritance patterns of plastid in kiwifruit. Here, we present an efficient plastid transformation protocol for kiwifruit (Actinidia chinensis cv. ‘Hongyang’). The establishment of transplastomic technology will probably enable new synthetic biology applications in kiwifruit plastids.
RESULTS
Construction of kiwifruit plastid transformation vector
The reporter gene GFP (green fluorescent protein) and selective marker gene (aadA) cassettes of kiwifruit plastid transformation vector pYY34 derived from pYY11(Part: BBa_K5044311), which was similar with pYY12 except for a restriction enzyme site [12]. The pYY11(Part: BBa_K5044311) was produced by co-transforming the backbone of pYY12 digested by NcoI and XbaI and GFP fused with ~30-bp homology amplified with prime pair GFP-NcoI-F/GFP-NotI-R (Figure 2).
Figure 2. Generation of plastid transformation pYY11. A. Construction of pYY11(Part: BBa_K5044311) based on pYY12 (Wu et al. 2017). The only difference between them is the restriction site at the end of GFP.
The pYY34 vector was generated by ligating four digested DNA fragments using T4 DNA ligase. These fragments included the backbone obtained by digesting pBluescripII KS(+) with SacI and KpnI, the GFP and aadA expression cassettes excised from pYY11(Part: BBa_K5044311) with SalI and SpeI [12], and the left homologous recombination region (LHRR, 1,092 bp) digested with KpnI and SalI and the right homologous recombination region (RHRR, 1,185 bp) digested with BlnI and SacI. The corresponding flanking sequences for homologous recombination were obtained by PCR amplification from the kiwifruit chloroplast genome (NCBI access number: NC_026690.1) using primer pairs (KpnI)AcLHRR-F/(SalI)AcLHRR-R and (BlnI)AcRHRR-F/(SacI)AcRHRR-R, respectively. For the construction of pQQC7, the CrPpsbA and aadA fragments were PCR amplified using primer pairs (ApaI)CrPpsbA-F/(g10)CrPpsbA-R and (g10)aadA-F/(SphI)aadA, respectively, using pYY34 as the template. Subsequently, an overlap-extension PCR was performed to obtain a CrPpsbA-aadA fragment separated by the 5′ UTR from gene10 of bacteriophage T7 (T7g10). Finally, both the CrPpsbA-aadA fragment and pYY34 were excised with ApaI/SphI and ligated to generate the pQQC7 (NCBI access number: PP816932; plasmid number: 221601, Addgene; Figure 2B). The All the primers are listed in Table 1.
Figure 3. Generation of kiwifruit plastid transformation pQQC7. The pYY34 was produced by ligating the backbone of pBluescript II KS (+), GFP and aadA cassettes from pYY11(Part: BBa_K5044311), LHRR and RHRR from kiwifruit plastid genome. A T7g10 sequence was inserted between CrPpsbA and aadA gene to generate pQQC7.
Production and analyses of transplastomic kiwifruit plants
After placed on an osmotic medium (agar-solid MS medium, 0.1 M sorbitol, 0.1 M mannitol, 3% sucrose) in the dark overnight (Figure 4A), sterile kiwifruit leaves were bombarded with plasmid pQQC7 using a 1100 psi rupture disk at target distance of 9 cm. Following the biolistic bombardment, the leaf samples were diced into 5 × 5 mm and were placed on regeneration media (agar-solid MS medium, 3% sucrose, a combination of 1 mg/L thidiazuron (TDZ), 2 mg/L 6-benzyladenine (6-BA) and 1 mg/L α-naphthalene acetic acid (NAA). Primary spectinomycin-resistant green calli began to appear after three months of incubation of bombarded leaf explants on regeneration media including 300 mg/L spectinomycin. Consequently, primary spectinomycin-resistant calli started to appear after three months. After six months of selection, six green calli were obtained from 12 plates (Figure 4C). Six independent transplastomic lines (Ac-pQQC7) underwent elongation and multiplication on shoot multiplication medium (AcSmM) containing 300 mg/L spectinomycin (Figure 4D, E). To achieve homoplasmy, the young leaves of these transplastomic lines underwent additional rounds of regeneration (Figure 4F, G). After induction of rooting (Figure 4H, I), the transplastomic lines were transferred to soil and did not exhibit any discernible phenotypic difference when compared with the wild type (Figure 4J).
Figure 4 Generation of plastid-transformed kiwifruit. A Preparation of kiwifruit leaves for particle bombardment. B Bombarded leaf explants were exposed to AcReM3 containing spectinomycin. Spectinomycin was used to select for transplastomic lines. C Spectinomycin-resistant calli appeared after three months selection, indicating successful plastid transformation. D, E These calli were able to grow into shoots. F, G The leaves of these lines were subjected to additional rounds of regeneration in order to achieve homoplasmy. (H,I) Progression of shoot growth and root induction of transplastomic lines (Ac-pQQC7). Transplastomic lines showed normal shoot growth and development of roots. A timeline illustrating the estimated approximate duration of the individual steps in the protocol is given below. K Growth comparison between transplastomic Ac-pQQC7 and wild-type (Ac-WT) plants in a greenhouse. Transplastomic plants exhibited similar growth patterns to wild-type plants.
Homoplasmy confirmation of plastid-transformed kiwifruit
To confirm the presence of the transgene in the shoots, we performed PCR using specific primers (GFP-F/GFP-R) designed for the GFP gene (Figure 5A). This resulted in the amplification of a 720-bp PCR product (Figure 5B), indicating the presence of the GFP gene. Moreover, we designed a primer pair (psaB-aadA-F/psaB-aadA-R) to target the psaB region of the native chloroplast genome and the aadA marker, respectively. PCR amplification with these primers yielded a 2.9 kb product (Figure 5C). Two PCR-positive lines (Ac-pQQC7#1, #6) were confirmed to have reached homoplasmy through Southern blot analysis. In the wild-type plants (Ac-WT), a 2.9 kb fragment was detected, while in the Ac-pQQC7, a 5.7 kb fragment corresponding to the integration of the transgene was observed (Figure 5D).
Figure 5. Verify the homoplastic status of transplastomic kiwifruit plants *'Ac*'-pQQC7. A Physical maps of the targeting region in the kiwifruit plastid genome (ptDNA, left) and the plastid transformation vector pQQC7. B, C PCR amplification using GFP-specific primes and psaB-aadA-F/psaB-aadA, which yield 720 bp (B) and 2.9 kb (C) amplicons, respectively, confirmed the presence of the transgene in Ac-pQQC7 plants. D Southern blot analysis verified the homoplasmy of Ac-pQQC7. A ~ 5.7 kb signal was observed in Ac-pQQC7, while the untransformed plants showed a 2.9 kb band on hybridization with the psaB probe.
Determination of GFP expression levels in transplastomic plants
To examine GFP expression, we performed a Northern blot using a hybridization probe specific for the GFP coding region. The blots revealed two transcripts, with the smaller and more abundant transcript representing the expected full-length GFP mRNA (Figure 6A). To determine the accumulation level of GFP, we conducted Western blot analysis using an anti-GFP antibody and a dilution series of recombinant GFP as a reference. The anti-GFP antibody successfully detected a 27 KDa GFP peptide, confirming GFP production in the transplastomic lines (Figure 6B). Based on our estimation, GFP accumulation reached approximately 2.5% of the TSP (Figure 6C).
Figure 6. Analysis of GFP expression in transplastomic kiwifruit plants. A Northern blot analysis of the GFP transcripts. B Western blot analysis confirmed the accumulation of GFP in Ac-pQQC7 leaves using an anti-GFP antibody. The larger bands are likely the results of read-through transcripts owing to inefficient transcription termination in plastids [13, 14]. C Semi-quantitative analysis of GFP accumulation in Ac-pQQC7 using a dilution series of recombinant GFP (rGFP).
Subcellular localization of GFP in transplastomic plants
Furthermore, the presence of GFP fluorescence specifically in chloroplasts confirmed its confinement to the chloroplast compartment in the leaves of the Ac-pQQC7 lines (Figure 7).
Figure 7 Verificaiton of plastid GFP expression in leaf cells using confocal laser-scanning microscopy. From left to right: GFP fluorescence (green), chlorophyll autofluorescence (red), and merged images.
Table 1 Primers used in this work. Recognition sequences of introduced restriction sites are underlined. The T7 promoter sequence is indicated in italics.
| Name | Sequence (5' to 3') | Description and Use |
|---|---|---|
| GFP-NotI-F | CTTTAAGAAGGAGATATACCCATGGTGAGTAAAGGAGAAGAACTTTTCACTG | Forward primer for PCR amplification of GFP; the primer has 30 base overlapping regions (pYY11(Part: BBa_K5044311) construction). |
| GFP-NotI-R | AGCCTTTCGTTTTATTTGATGCGGCCGCTCATTGTACAGCTCGTCCATGCC | Reverse primer for PCR amplification of GFP; the primer has 30 base overlapping regions (pYY11(Part: BBa_K5044311) construction). |
| (KpnI)AcLHRR-F | GGTACCCGGTCTGGGCGTGGATGTTC | Forward primer for PCR amplification of left homologous recombination region (LHRR) of kiwifruit plastid genome; introducing a KpnI restriction site (pYY34 construction). |
| (SalI)AcLHRR-R | GTCGACCTTAAGCTCGAGCACCTCTTTTCCGTCCATCCC | Reverse primer for PCR amplification of LHRR of kiwifruit plastid genome; introducing a SalI restriction site (pYY34 construction). |
| (BlnI)AcRHRR-F | CCTAGGGCTAGCCCCGGGGGTAGAACCATTACACTATCACTGCC | Forward primer for PCR amplification of right homologous recombination region (RHRR) of kiwifruit plastid genome; introducing a BlnI restriction site (pQQC7 construction). |
| (SacI)AcRHRR-R | GAGCTCTCTGGCTTGGCTAGGTGGGATA | Reverse primer for PCR amplification of RHRR of kiwifruit plastid genome; introducing a SacI restriction site (pQQC7 construction). |
| (ApaI)CrPpsbA-F | GGGCCCGGTACCATAACTTCG | Forward primer for PCR amplification of the CrPpsbA and CrPpsbA-aadA fragments; introducing a ApaI restriction site (pQQC7 construction). |
| (g10)CrPpsbA-R | CCGCTTCCCCCATATGTATATCTCCTTCGATGTTAATTTTTTTAAAGTTTTAATTTCTC | Reverse primer for PCR amplification of the CrPpsbA fragment (pQQC7 construction). |
| (g10)aadA-F | CTTTAAAAAAATTAACATCGAAGGAGATATACATATGGGGGAAGCGGTGATCGCCGAAG | Forward primer for PCR amplification of the aadA fragment; the primer and (g10)CrPpsbA-R primer have 47 base overlapping regions (pQQC7 construction). |
| (SphI)aadA-R | GCATGCCCTAGACATTATTTGCCGAC | Reverse primer for PCR amplification of the aadA and CrPpsbA-aadA fragments; introducing a SphI restriction site (pQQC7 construction). |
| GFP-F | ATGGTGAGTAAAGGAGAAGAAC | Forward primer for PCR amplification of GFP fragment (PCR assay). |
| GFP-R | TTACTTGTACAGCTCGTCCAT | Reverse primer for PCR amplification of GFP fragment (PCR assay). |
| AcpsaB-aadA-F | GACGAGGCGGTACTTGTGA | Forward primer for PCR amplification of psaB-aadA fragment (PCR assay). |
| AcpsaB-aadA-R | CACTGCGGAGCCGTACAAATGT | Reverse primer for PCR amplification of psaB-aadA fragment (PCR assay). |
| AcpsaB probe-F | AGACCTCCTCCCCATCAAAAGAAAT | Forward primer for PCR amplification of psaB probe (Southern blot). |
| AcpsaB probe-R | TGCACGCGGTTCCAAGTTAATG | Reverse primer for PCR amplification of psaB probe (Southern blot). |
| GFP probe-F | CTTGTTGAATTAGATGGTGATGTTA | Forward primer for PCR amplification of GFP probe (northern blot). |
| GFP-T7 probe-R | TAATACGACTCACTATAGGGGCCATGTGTAATCCCAGCAG | Reverse primer for PCR amplification of GFP probe, introducing the promoter sequence of T7 RNA polymerase (northern blot). |
Detection of GFP fluorescence signal
Subcellular localization of GFP fluorescence in leaves of wild-type and transplastomic plants was determined by confocal laser-scanning microscopy (LSM 980; Zeiss) using an argon laser for excitation (at 488 nm), a 491–654 nm filter for detection of GFP fluorescence and a 646–728 nm filter for detection of chlorophyll fluorescence.
Table 2: Basic Parts of pQQC7
| Code | Name | Function & Description | Type | Length (bp) | Authors |
|---|---|---|---|---|---|
| BBa_K5044038 | NtPrrn Promoter | Tobacco 16S rRNA promoter, used to drive the expression of GFP. | Promoter | 145 | Chuming Chen, Qiqi Chen |
| BBa_K5044037 | T7g10 RBS | Ribosome binding site from T7 phage gene 10, enhances translation efficiency. | RBS | 12 | Chuming Chen, Qiqi Chen |
| BBa_K5044033 | GFP | Green Fluorescent Protein, used as a reporter gene. | CDS | 720 | Chuming Chen, Qiqi Chen |
| BBa_K5044021 | CrPpsbA Promoter | Chlamydomonas reinhardtii psbA promoter, used to drive the expression of aadA. | Promoter | 273 | Chuming Chen, Qiqi Chen |
| BBa_K5044037 | T7g10 RBS | Ribosome binding site from T7 phage gene 10, enhances translation efficiency. | RBS | 12 | Chuming Chen, Qiqi Chen |
| BBa_K5044041 | aadA | Aminoglycoside 3'-adenylyltransferase, used as a selectable marker gene. | CDS | 792 | Chuming Chen, Qiqi Chen |
| BBa_K5044042 | CrTrbcL Terminator | Chlamydomonas reinhardtii rbcL terminator, used to terminate transcription. | Terminator | 450 | Chuming Chen, Qiqi Chen |
Adaptations to the original sequence were made for assembly compatibility
Dear iGEM Judges and Community Members,
We would like to provide an important clarification regarding the sequences we have uploaded for our project.
Background: We designed a set of sequences intended for plastid expression, which functioned normally in both kiwifruit (Actinidia chinensis) and tobacco (Nicotiana tabacum). To ensure these sequences comply with iGEM's Assembly Compatibility standards (i.e., 10 or 1000 compatibility), we performed codon optimization. However, this optimization was based on nuclear expression principles.
Issue: In reality, the unoptimized sequences already worked well in the plastid environment. Due to the iGEM upload requirements, we had to optimize the sequences, which may render them non-functional in the plastid context.
Solution: To address this issue, we have uploaded both the unoptimized, functional plastid-expressing sequences and the codon-optimized versions. Specifically:
•Unoptimized Plastid-Expressing Sequence: BBA_K5044044
•Codon-Optimized Sequence: BBA_K5044310
These two parts are essentially the same plasmid, pQQC7, but the latter has been optimized for nuclear expression to meet the iGEM system requirements. For the competition, we have submitted the codon-optimized version, BBA_K5044310, but we have also provided the unoptimized version, BBA_K5044044, as a reference.
Summary: We hope this explanation helps the judges and other users understand our approach and ensures they can choose the appropriate sequence for their applications. Both parts are valid, but for plastid expression, please use BBA_K5044044.
Thank you for your understanding and attention.
Sincerely,
iGEM24_HUBU-China Team
References
Bock R (2001) Transgenic plastids in basic research and plant biotechnology. J Mol Biol 312: 425‒438.
[1] Oey M, Lohse M, Kreikemeyer B, Bock R, Exhaustion of the chloroplast protein synthesis capacity by massive expression of a highly stable protein antibiotic. Plant J 57 (2009) 436–445.
[2] Castiglia D, Sannino L, Marcolongo L, Ionata E, Tamburino R, et al., High-level expression of thermostable cellulolytic enzymes in tobacco transplastomic plants and their use in hydrolysis of an industrially pretreated Arundo donax L. biomass. Biotechnol Biofuels 9 (2016) 154.
[3] Bock R, Engineering plastid genomes: methods, tools, and applications in basic research and biotechnology. Annu Rev Plant Biol 66 (2015) 211–241.
[4] Yang S, Deng Y, Li S, Advances in plastid transformation for metabolic engineering in higher plants. aBIOTECH 3 (2022) 224–232.
[5] Scharff LB, Bock R, Synthetic biology in plastids. Plant J 78 (2014) 783–798.
[6] Boynton J, Gillham N, Harris E, Hosler J, Johnson A, et al., Chloroplast transformation in Chlamydomonas with high velocity microprojectiles. Science 240 (1988) 1534–1538.
[7] Svab Z, Hajdukiewicz P, Maliga P, Stable transformation of plastids in higher plants. Proc Natl Acad Sci USA 87 (1990) 8526–8530.
[8] Liu Y, Li F, Gao L, Tu Z, Zhou F, et al., Advancing approach and toolbox in optimization of chloroplast genetic transformation technology. J Integr Agr 22 (2023) 1951–1966.
[9] Yue J, Liu J, Tang W, Wu YQ, Tang X, et al., Kiwifruit Genome Database (KGD): a comprehensive resource for kiwifruit genomics. Hortic Res 7 (2020) 117.
[10] Li K, Liu L, McClements DJ, Liu Z, Liu X, et al., A review of the bioactive compounds of kiwifruit: bioactivity, extraction, processing and challenges. Food Rev Int 40 (2023) 996–1027.
[11] Li D, Qi X, Li X, Li L, Zhong C, et al., Maternal inheritance of mitochondrial genomes and complex inheritance of chloroplast genomes in Actinidia Lind.: evidences from interspecific crosses. Mol Genet Genomics 288 (2013) 101–110.
[12] Wu Y, You L, Li S, Ma M, Wu M, et al., In vivo assembly in Escherichia coli of transformation vectors for plastid genome engineering. Front Plant Sci 8 (2017) 1454.
[13] Zhou F, Karcher D, Bock R, Identification of a plastid intercistronic expression element (IEE) facilitating the expression of stable translatable monocistronic mRNAs from operons. Plant J 52 (2007) 961–972.
[14] Lu Y, Stegemann S, Agrawal S, Karcher D, Ruf S, et al., Horizontal transfer of a synthetic metabolic pathway between plant species. Curr Biol 27 (2017) 3034–3041.
| None |