Coding
Part:BBa_K197011:Design
Designed by: Gabriela Guzman Lopez Aguado Group: iGEM09_Berkeley_Wetlab (2009-10-21)
{TshA}
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 861
Illegal PstI site found at 1206 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 861
Illegal PstI site found at 1206 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 861
Illegal PstI site found at 1206 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 861
Illegal PstI site found at 1206
Illegal NgoMIV site found at 1347 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
This part is in BglBricks Standard. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BglBricks Standard is available at:
[http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BglBricks Standard Description Page]
Source
PCR ca998/O09ig283 on M10088 (1575, EcoRI/BamHI) Sub in pBca9523-Bca1144#5 (EcoRI/BamHI, 2472+1224, L) Product is pBca9523-O09ig283 {<TshA>} ------------------------------------- Ca998 forward oligo gtatcacgaggcagaatttcag O09ig283 reverse oligo with stop codons removed for {<TshA>} gacggGGATCCgaatgaataacgaatattag