Part:BBa_K5317021
CMV-ATF2-mRuby2
Usage and Biology
ATF2 belongs to the mammalian ATF/CREB family (Kirsch et al., 2020) and gets phosphorylated by the antibiotic-detecting PknB-kinase (K5317013) of our sensor system. mRuby2 provides a fluorescent marker for visualization. In our cell-based & #946;-lactam ring-containing antibiotics sensor, ATF2 serves as a translator of changes in PknB activity at the level of gene regulation, in particular the activity of our engineered ATF2-3xCre2xAP1 promoter (K5317017).
Cloning
Theoretical Part Design
We placed the mRuby2 fluorescent marker (K5317001) downstream of ATF2 (K5317016), leading to a fusion of the reporter C-terminally. The CMV promoter, provided by the EGFP-C2 backbone (K3338020), enabels a constitutive expression of the fusionprotein in mammalian cells (Radhakrishnan et al., 2008).
Sequence and features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 670
Illegal SapI.rc site found at 2408
Cloning
The ATF2 insert was synthesized and the mRuby2 sequence amplifyed using the primers in table 1. The primers ensured approx. 20 bp-long overhangs at the 5' and 3' ends of the amplicons compatible with the backbone. We linearized EGFP-C2 with BamHI and AseI. The composite part-containing plasmid was assembled using the NEBBuilder® HIFI assembly kit, whereby the overhangs ensured the correct positioning of the insert in the backbone.
| Primer name | Sequence |
|---|---|
| ATF2_fw | TGAACCGTCAGATCCGatgaaattcaagttacatgtgaattctgccag |
| ATF2_rev | ggatccccacttcctgagggctgtgac |
| mRuby2_fw | caggaagtggggatccaccggtcg |
| mRuby2_rev | TCAGTTATCTAGATCCGGTGcttgtacagctcgtccatccc |
Figure 1: Assembled vector map with the ATF2 and mRuby2 inserts integrated into the pEGFP-C2 backbone, whereby mRuby2 is positioned downstream of ATF2, ensuring its C-terminally fusion to ATF2.
Characterisation
Transfection experiments in mammalian HEK293T cells assessed the functionality and sensitivity of ATF2. First, the composite part carrying plasmid was introduced via transfection to ensure the physiological localisation of ATF2 before co-transfecting experiments with the CMV-EGFP-PknB carrying plasmid (K5317018) and 3xCre3xAP1-miniCMV carrying plasmid (K5317022). The mRuby2 fluorescence signal was analyzed for localization by microscopy and quantifyed by FACS analysis.
Single-transfection experiments
To determine the basal expression and localization of ATF2 under unstimulated conditions, ATF2-mRuby2 expressing HEK293T cells were imaged without the presence of ampicillin.
Figure 2: Single-transfected HEK293T cells with the ATF2-mRuby2-C2 plasmid depicted under unstimulated conditions. Scale bar = 20 µm.
The correct expression of ATF2-mRuby2 was assumed, since the representative images in figure 2 show a moslty nuclear localization of the mRuby2 signal in HEK293T cells. The already primary nuclear localisation of ATF2 could be due to other mechanisms that activate ATF2 endogenously, since it is a mammalian transcription factor. Due to its physiological occurence in mammalian cells, we decided to use ATF2 as a crucial signal forwarding factor to mediate between the detecting PknB protein and the signal emitting 3xCre3xAP1-miniCMV promoter.
Co-transfection with PknB-EGFP
Double transfection shows that PknB and ATF2 do not inhibit each other's co-expression and shows that both are interacting. This paring of kinase and transcription factor can be used for further experiments with the ATF-Cre3x-3xAPI-promoter. Under ampicillin stimulating conditions, both signals increase slightly.
Figure 3: The montage double-transfected CMV-PknB-eGFP and CMV-ATF2-mRuby2 in HEK cells with and without ampicillin stimulation.
The co-transfection (Figure 4) shows an image expressing HEK cells of CMV-PknB-eGFP and CMV-ATF2-mRuby2. Shown are brightfield (left), fluorescence channels for eGFP and mRuby2 and an overlay of the three channels with and without coloured signals (right).
Co-transfection experiments with PknB and ATF2-Cre3x-API3x
The parts ATF2-EGFP, PknB-mRuby2and ATF2-3xCre3xAP1-Promoter_miniCMV_miRFP670 were co-transfected into HEK cells, with and without stimulating conditions, to detect a significant increase of fluorescent signal intensity . This shows if our own promoter is actually recognised by the native ATF2 or the transfected ATF2 and to provide a statement on the functionality of our biosensor.
Figure 4: Representative microscopy image of HEK cells expressing EGFP-PknB, ATF2-mRuby2 and ATF2-3xCre3xAP1-Promoter_miniCMV_miRFP670. Shown are the fluorescence channels for eGFP, mRuby2 and miRFP670 (first three images from the left) and an overlay of the three channels (right). In a) is shown the basal activity of the promoter. In b) is shown the promoter activity after induction with 100 µg/mL ampicillin after four hours of incubation.
Shown HEK cells (Figure 4) co-transfected with our composite parts EGFP-PknB and ATF2-mRuby2 as well as our tested promoter-driven reporter. ATF2 expression is shown in red and the respective reporter miRFP670 expression, which indicated a basal promoter activity, in pink. Particularly noteworthy here is again the correct localization of the prokaryotic membrane protein PknB in the eukaryotic cell membrane, in green. To study whether the presence of beta-lactam antibiotics in the cell media will be sensed by PknB, leading to a phosphorylation of ATF2 and subsequently to an induction of our promoter-driven reporter fluorophore, we incubated co-transfected HEK293T cells with ampicillin (100 µg/mL) for four hours. This shows a higher fluorescent signal in our synthetic promotor compared to unstimulated conditions.
References
Kirsch, K., Zeke, A., Tőke, O., Sok, P., Sethi, A., Sebő, A., Kumar, G. S., Egri, P., Póti, Á. L., Gooley, P., Peti, W., Bento, I., Alexa, A., & Reményi, A. (2020). Co-regulation of the transcription controlling ATF2 phosphoswitch by JNK and p38. Nature Communications, 11(1), 5769. https://doi.org/10.1038/s41467-020-19582-3
Radhakrishnan, P., Basma, H., Klinkebiel, D., Christman, J., & Cheng, P.-W. (2008). Cell type-specific activation of the cytomegalovirus promoter by dimethylsulfoxide and 5-Aza-2’-deoxycytidine. The International Journal of Biochemistry & Cell Biology, 40(9), 1944–1955. https://doi.org/10.1016/j.biocel.2008.02.014
| None |