Part:BBa_K5201001
kfiD codons are optimized for overexpression of UDP-glucose-6-dehyrogenase
Biology kfiD encodes UDP-glucose-6-dehydrogenase (UGDH) from E. coli K5 strain.
Usage and design UGDH is endogenously expressed in a low level in E. coli, our recombinant plasmid will overexpress UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of kfiD can increase production of Hyaluronic Acid (HA), by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use.
Usage and Biology
Characterisation of BBa_K5201001: HongKong-UCCKE
Part registry |
BBa_K5201001 |
Part type |
Coding sequence |
Short description |
kfiD is a gene originated from E. coli K5 strain, codons are optimized for overexpression of UDP-glucose-6-dehydrogenase (UGDH) in E. coli |
Long description |
Biology kfiD encodes UDP-glucose-6-dehydrogenase (UGDH) from E. coli K5 strain. Usage and design UGDH is endogenously expressed in a low level in E. coli, our recombinant plasmid will overexpress UGDH under an inducible promoter (BBa_R0010). We hope that overexpression of kfiD can increase production of Hyaluronic Acid, by converting UDP-glucose to UDP-glucuronic acid, one of the precursors of HA. HA is widely utilized by the cosmetic industry for its significant water absorption and retention properties. And therefore, we want to further implement it for agricultural use. |
Source |
E. coli K5 strain |
Design consideration |
kfiD is designed to optimize over-expression for E. coliI. This ensures a high amount of UDP-glucuronic acid, and hence, HA can be produced |
Sequence |
gaattcgcggccgcttctagagatgcatcaccatcatcaccacttcggtaccctgaagatcacggtcagcggtgcgggctacgtgggtctttccaatggcatcctcatggcccagaaccacgaagtagtggcttttgatacccaccagaaaaaagtggatttactgaacgacaaattgagcccgattgaagataaggaaatcgagaattacctgtccacaaagatcttaaactttcgcgccactaccaataagtatgaagcctacaaaaatgcaaactatgtaattatcgcgacgccgactaattatgaccccggttctaactatttcgataccagtagtgtcgaagcggtgattcgtgatgtcacggaaatcaatccgaacgcgataatggttattaagagcaccgttccggtcggattcacgaaaactattaaagaacatctgggtatcaataacattatttttagtcccgaatttctgcgtgaaggccgcgcgttatatgacaacctacatccgtcacgcatcatcattggtgagcgctctgagcgcgcggaacgtcttgcggtgttattccaggaaggcgctatcaaacaaaatattcctgttttgtttaccgactcaaccgaagcagaagccataaaactgtttagcaacacatatctggcgatgcgagttgcattcttcaacgagctggatagctacgcagaaagcttcggactgaatacacgacagatcattgatggggtatgcctggatcctcgcattggcaactactacaataaccctagctttggttatggcggctattgcctgccgaaagataccaagcagctgcttgcgaactatcagtcagtgccgaacaaacttatttcggccattgtcgatgcaaatcgcaccaggaaagatttcatcaccaatgtgattttgaagcatcgtccacaagtagtgggcgtttatcgtctgattatgaaaagtggatcggataacttccgcgactcgtcaattctgggcattatcaaacgtatcaaagaaaaaggcgtgaaagttattatatacgagccgttgatttccggggatactttttttaactctccactcgagcgtgagctggccatttttaaagggaaagccgacattattattacgaatcgcatgagcgaagaattaaatgacgttgtggataaagtgtactcgcgggacctctttaaatgtgattactagtagcggccgctgcag |
Start codon |
|
Stop codon |
|
Assembly compatibility |
rfc10 |
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 200
Illegal BamHI site found at 732
Illegal XhoI site found at 1075 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
None |