Part:BBa_K5228000

Thermostable Terminal deoxynucleotidyl Transferase (ThTdT)

Thermostable Terminal Deoxynucleotidyl Transferase (ThTdT) is a mutated template-independent DNA polymerase originating from Bos taurus. This protein coding basic part performs template-free nucleotide (dNTP) addition at the 3’ end, requiring a starting primer. Recombinantly isolated from DH5α E. coli, the enzyme is a thermostable variant of its wild type counterpart enabling an increased working temperature range of 37°C to 55°C (as tested) and requires a divalent cation such as Co²⁺ to increase its 3’-extension efficiency (used in characterization experiments).

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal EcoRI site found at 275
  
• 12
  INCOMPATIBLE WITH RFC[12]

  Illegal EcoRI site found at 275
  
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal EcoRI site found at 275
  Illegal BglII site found at 164
  Illegal BglII site found at 431
  Illegal BglII site found at 799
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal EcoRI site found at 275
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal EcoRI site found at 275
  
• 1000
  COMPATIBLE WITH RFC[1000]

1. Usage and Biology

1.1 Terminal deoxynucleotidyl Transferase (TdT)

1.1.1 Wild type TdT (WT TdT) Overview

What is the WT TdT enzyme and what is its function?

Fig. 1.1: Terminal deoxynucleotidyl Transferase (TdT) catalyzes the addition of nucleotide triphosphates (dNTPs) to the 3’-termini of single stranded DNA (ssDNA).

Terminal deoxynucleotidyl transferase (TdT) is a uniquely template-independent DNA polymerase (Ashley et al., 2023). Chemically, TdT elongates the free 3’-hydroxyl termini of DNA molecules, typically a primer, using deoxyribonucleotide triphosphates (dNTPs) as substrates, forming inorganic pyrophosphate (PP_i) as a by-product. It plays a key role in diversifying the human cell receptor portfolio of T- and B- cell receptors by V(D)J recombination. This is achieved by adding non-templated nucleotides between the V, D, J exons (Motea & Berdis, 2010).

What organism does WT TdT originate from?

TdT belongs to the X family of polymerases, responsible for DNA repair in mammals (Hoitsma et al., 2020). It was one of the first mammalian polymerases to be identified, originally extracted from the cow thymus in 1960 (Bollum, 1960). Therefore, the wild type TdT (WT TdT) we use for our project (see below), nuCloud, comes from cows. Similarly, the thermostable TdT (ThTdT) used is also of bovine origin (Chua et al., 2020).

What is the chemical catalytic reactivity of WT TdT?

As a transferase (Enzyme Commission EC 2.7.7.31), TdT catalyzes the following reaction:

Oligonucleotide_n + dNTP → Oligonucleotide_n+1 + PP_i

How is WT TdT's reactivity modulated?

WT TdT has optimal activity at approximately 37ºC, and it inactivates at 40ºC (Chua et al., 2020) (Boulé et al., 2000). TdT is also a metalloenzyme, where either one of Mg²⁺ or Mn²⁺ is required for catalytic activity (Pandey et al., 1987). Other divalent transition metal cations, such as Co²⁺ and Zn²⁺ are known to enhance its transferase activity, especially with dCTP and dTTP (Grosse et al., 1993; Ratliff, 1981).

1.1.2 Thermostable TdT (ThTdT) Overview

What are the limitations of WT TdT? Why do they matter?

As TdT adds nucleotides to the growing ssDNA strand, the increasing sequence length reduces the energetic stability of the ssDNA (Bochman et al., 2012). This causes the oligonucleotide strand to fold back on itself, forming undesired secondary structures. These secondary structures, in particular, have been shown to reduce the efficiency of TdT activity (Barthel et al., 2020).

How can Thermostable TdT (ThTdT) help?

Fig. 1.2: Comparison of thermostability and function between WT TdT and ThTdT between 37ºC and elevated temperatures.

To address the incumbrance of secondary structures, increasing the reaction temperature is a preferable approach, as it weakens intramolecular hydrogen bonds and prevents the formation of secondary structures (Barthel et al., 2020). To facilitate the reaction at elevated temperatures, we engineered a more thermostable version of TdT using synthetic biology techniques, which we named thermostable TdT (ThTdT). ThTdT is designed to retain functionality at elevated temperatures, enabling reliable long oligonucleotide production without secondary structure interference. According to Barthel et al. (2020), ThTdT was shown to function up to 47ºC, 10 ºC higher than the unmodified TdT.

How did the mutations change the structure of TdT relative to wild type?

INSERT FIGURE 3 @NARJIS

ThTdT carries 11 point mutations relative to the wildtype, where 9 are outside of the substrate binding pocket. Within the binding pocket, two substitution mutations were found in the active site, M339K and T340I. Notably, M339K afforded a new hydrogen bond that is predicted to interact with G337, which may confer higher thermostability alongside with other mutations.

1.2 Current Applications of TdT

Beyond applications in DNA data storage, TdT is used in other areas of research and industry:

• Research

  • Molecular probe generation
    • Using chemically modified nucleotide triphosphates, such as fluorophore and digoxigenin conjugates, antisense based molecular probes were synthesized by TdT to generate highly specific targeting agents for biological imaging and disease etiology studies (Lu et al., 2022).
  • Polynucleotide synthesis
    • Standard DNA synthesis uses phosphoramidite chemistry and require punctiliously anhydrous and volatile organic reagents, as opposed to chemoenzymatic synthesis that occurs in aqueously buffered salts (Barthel et. al, 2020). Pivoting to enzymatic synthesis via optimized use of polymerases, like TdT, provides scope for cheaper and greener polynucleotide synthesis.
  • DNA nanotechnology
    • TdT has been demonstrated to aid in the assembly of DNA nanostructures such as hydrogels. DNA hydrogels require DNA building blocks, which can be enzymatically synthesized using TdT (Xiang et. al, 2016). TdT can be used to add complementary DNA tails to the building blocks which allows for hybridization between the blocks and formation of the gel structure.
  • Biosensors
    • TdT has been applied to develop new biosensing platforms as well as to amplify the output of biosensors. TdT’s ability to add multiple nucleotides of the same base can be used to generate poly dA tails. These polynucleotide tails have been used for sensitive detection of the activity of various molecules such as uracil-DNA glycosylase (Du et. al, 2021).

• Industry

  • Companies have also started adopting the use of TdT in developing new products to perform DNA synthesis. DNAScript launched the first benchtop DNA printer, SYNTAX, run on enzymatic DNA synthesis technology, and TdT plays a critical role in the elongation of DNA in the workflow (Grinstein, 2023).

1.3 Usage with nuCloud

1.3.1 About nuCloud

What is the purpose of the project?

Fig. 1.4: ThTdT as the centerpiece data-writing basic part of UBC iGEM 2024’s biomanufacturing data storage technology, nuCloud.

Our project, nuCloud, aims to address the need for a sustainable, more energy-efficient data storage medium compared to current magnetic and optical data storage options. One direction through which we tackle this issue is by developing an enzymatic DNA synthesis platform that can elongate single-stranded DNA (ssDNA) in a template-independent manner. The synthesized ssDNA strand will then be converted to a more stable, double-stranded DNA (dsDNA) and can be inserted into a plasmid for long-term data storage. We will leverage TdT’s ability to elongate DNA in a template-independent manner to perform enzymatic synthesis of the original ssDNA strands that are needed for data storage.

1.3.2 ThTdT in nuCloud

In nuCloud, ThTdT enables synthesis of custom nucleotide sequences encoding data for storage efficiently and sustainably. Even with the efficiency gains of ThTdT, template-free DNA synthesis remains a highly repetitive process, adding only one nucleotide per reaction cycle. To overcome this, we leverage microfluidic platforms to automate the synthesis process, and on top of that, minimize the amount of ThTdT and reagents used.

Liquid Phase Synthesis (LPS)

Prior to solid-phase DNA synthesis, where the primer sequence is immobilized to a glass slide, we tested our ThTdT in a conventional liquid-phase system to verify its ability to add nucleotides to the primer. Liquid-phase synthesis refers that all components. - the ThTdT enzyme, deoxyribonucleotide triphosphates (dNTPs), primer, and Co²⁺ - are in solution. The simple setup also allowed us to perform characterization tests on ThTdT over a range of temperatures and concentrations.

Solid-phase synthesis (SPS)

Solid-phase DNA synthesis is the strategy that immobilizes the primer to be extended onto a solid support. Unlike LPS, an immobilized primer means that after a nucleotide has been added, the liquid phase can be washed away and a new solution containing the next nucleotide can be added, akin to solid phase oligonucleotide synthesis without the harmful chemicals. This strategy allows us to precisely control the bases added per cycle, allowing us to synthesize any DNA sequence suitable for storing data. We designed and produced reusable microfluidic chips to facilitate solid-phase enzymatic DNA synthesis with our ThTdT, enabling resource-saving small reaction volumes, and an automated workflow.

2. Characterization of ThTdT

2.1 Designing the ThTdT Gene Fragment

To generate the Thermostable TdT gene fragment (ThTdT), the DNA sequence from Chua et al. (2020) was used to combine with an N-terminal $\text{His}_6$-tag, thrombin cleavage site, and SUMO tag in silico. (Fig 2.1).

Fig. 2.1: ThTdT gBlock: 6xHis Tag, Thrombin site, SUMO tag, ThTdT gene sequence. 1515bp.

The in silico result was synthesized via the IDT gBlock synthesis service.

2.2 Cloning of ThTdT

The pET-28b plasmid backbone was obtained from Novagen. To remove multiple cloning site (MCS) and undesirably positioned His₆-tag from pET-28b, inverse PCR was performed on pET-28b plasmid. A 30 bp overhang in the ThTdT gene fragment was included in preparation for Gibson assembly (Figure 2.2).

Fig. 2.2: Diagnostic PCR results using agarose electrophoresis. I1+I2: Amplicon product from pET-28b by inverse PCR using primers P5, P6, expected product size 5198 bp, A1+A2: Amplicon product of ThTdT via PCR using primers P3, P4, expected product size 1545 bp. Ladder: 1 kb DNA size ladder, 10% Agarose gel, 45 min, 120 V, SYBR Safe. P3: TTCCTTTCGGGCTTTGTTAGCAGCCGGATCCTAAGCATTTCTTTCCCATGGTTCA, P4: ATTTTGTTTAACTTTAAGAAGGAGATATACATGGGCAGCAGCCATCATC, P5: ATGGCTGCTGCCCATGTATATCTCCTTCTTAAAGTTAAACA, P6: GAAAGAAATGCTTAGGATCCGGCTGCTAACAAAGC.

Fig. 2.3: pET-28b(+) plasmid map with ThTdT insert.

Using Gibson assembly, ThTdT was ligated with the modified pET-28b plasmid. The product was then transformed into chemically competent DH5α E. coli (Figure 2.4). Successful ligation and transformation were indicated via colony growth on an LB-Kanamycin (50 µg/mL) plate. Further validation was completed by colony PCR (Figure 2.5) and whole plasmid sequencing by Plasmidsaurus (Figure 2.6).

Fig. 2.4: LB-Kanamycin (50 µg/ml) plate, plated with DH5a Gibson assembly product transformed cells.

Fig. 2.5: Colony PCR confirmation of Gibson assembly and from LB-Kanamycin plate transformants using primers P3 and P4. 1 kb DNA size ladder. 10% Agarose gel, 45 min, 120 V, SYBR Safe. Product size of ~1500 bp. Ladder: 1 kb DNA size ladder, C1: Colony 1, C2: Colony 2, C3: Colony 3, C4: Colony 4, R1: ThTdT gBlock. P3:TTCCTTTCGGGCTTTGTTAGCAGCCGGATCCTAAGCATTTCTTTCCCATGGTTCA, P4:ATTTTGTTTAACTTTAAGAAGGAGATATACATGGGCAGCAGCCATCATC.

Fig. 2.6: Sequencing result of pET-28b(+)-ThTdT completed by Plasmidsaurus. Out of 6716 bases sequenced, in the ThTdT gBlock region, 2 silent mutations were detected: T4194G, C4629T.

2.3 Purification of ThTdT

Plasmids were extracted from DH5α and transformed into BL21 (DE3) for ThTdT protein expression (Fig 2.7). ThTdT expression was induced with IPTG in transformed BL21, followed by mechanical lysis to obtain crude cell lysate. Isolation of ThTdT was completed with Ni-NTA magnetic beads (New England Biolabs, NEB). Fractions containing ThTdT was confirmed via SDS-PAGE (Fig 2.8). To remove the excess imidazole from the protein elution buffer, the combined ThTdT-containing fractions were purified using Amicon® Ultra Centrifugal Filter system to concentrate the samples. For long term storage, the purified protein was formulated in NEB storage buffer in-house (50 mM potassium phosphate, 100 mM NaCl, 1.43 mM β-mercaptoethanol, 50% Glycerol, 0.1% Triton® X-100, pH 7.3 @ 25°C) that was recreated in-house. The storage buffer was also supplemented with 100 µM 2,2’-bipyridyl to remove residual contaminating $Ni^{2+}$ that was carried over from purification.

Fig. 2.7: LB-Kanamycin (50 µg/ml) plate, plated with 30 bp overhang Gibson assembly product.

Fig. 2.8:SDS-PAGE of ThTdT isolated after magnetic beads purification. 120 V, 1.5 h, Coomassie Blue staining. MW: Molecular Ladder, L: Cell lysate, E1: elution fraction 1, E2: elution fraction 2.

2.4 Proof of Function

2.4.1 Benchmark Establishment using WT TdT

Using the in-house ThTdT, 3’-elongation activity to Cy5-labeled primer P1 was observed using all four canonical nucleotide triphosphates at temperatures above 40ºC. This was chosen because it was the upper temperature limit for WT TdT to retain its function (Chua et al., 2020). In order to test this hypothesis, a liquid phase synthesis (LPS) system was devised to validate nucleotide addition. Firstly, WT TdT purchased from NEB was studied to develop a standard assaying condition for all four nucleotide triphosphates (Figure 2.9).

Fig. 2.9: Nucleotide addition to primer using WT TdT with varying dNTP concentration. Primer P1 /5Biosg/ ATT CGrA TCA /iCy5/CTA GCA TAC TAT CAT TCG GGG. [Primer] = 100 nM. Reaction Time = 30 min. Temperature = 37ºC. Denaturing Urea PAGE, 20%, 400 V, 30 min.

This supports the claim that our system was successful in catalyzing nucleotide addition and this condition could be used as a benchmark against our in-house ThTdT. This also validated that denaturing PAGE following fluorescent detection on a Typhoon biomolecular scanner was an efficacious workflow to visualize the results.

2.4.2 Functional Validation of ThTdT

With a benchmark assay available, the ability for our in-house ThTdT to incorporate nucleotide triphosphates to an oligonucleotide was studied. Gratifyingly, purified ThTdT stored in a modified NEB storage buffer was able to incorporate nucleotides in primer 2.

Fig. 2.10:3’-extension by wild type terminal deoxynucleotidyl transferase (WT TdT) and thermostable terminal deoxynucleotidyl transferase (ThTdT) using primer P2 /56FAM/AGCCTGTTGTGAGCCTCCTAAC at 37ºC for 15 min. [Primer P2] = 100nM, [CoCl2] = 250 µM, [dNTP] = 1 µM. 20% D-PAGE, 30 min, 400V. Imaged using Cy3 setting.

3. Potential Applications

FILL IN @NARJIS

4. References

• Ashley, J., Potts, I. G., & Olorunniji, F. J. (2023). Applications of Terminal Deoxynucleotidyl Transferase Enzyme in Biotechnology. Chembiochem : a European journal of chemical biology, 24(5), e202200510. https://doi.org/10.1002/cbic.202200510
• Barthel, S., Palluk, S., Hillson, N. J., Keasling, J. D., & Arlow, D. H. (2020). Enhancing Terminal Deoxynucleotidyl Transferase Activity on Substrates with 3' Terminal Structures for Enzymatic De Novo DNA Synthesis. Genes, 11(1), 102. https://doi.org/10.3390/genes11010102
• Bochman, M. L., Paeschke, K., & Zakian, V. A. (2012). DNA secondary structures: stability and function of G-quadruplex structures. Nature Reviews Genetics, 13(11), 770+. http://dx.doi.org/10.1038/nrg3296
• Boulé, J. B., Rougeon, F., & Papanicolaou, C. (2000). Comparison of the two murine terminal [corrected] deoxynucleotidyltransferase terminal isoforms. A 20-amino acid insertion in the highly conserved carboxyl-terminal region modifies the thermosensitivity but not the catalytic activity. The Journal of biological chemistry, 275(37), 28984–28988. https://doi.org/10.1074/jbc.M005544200
• Chua, J. P. S., Go, M. K., Osothprarop, T., Mcdonald, S., Karabadzhak, A. G., Yew, W. S., Peisajovich, S., & Nirantar, S. (2020). Evolving a Thermostable Terminal Deoxynucleotidyl Transferase. ACS synthetic biology, 9(7), 1725–1735. https://doi.org/10.1021/acssynbio.0c00078
• Du, Y.C., Wang, S.Y., Wang, Y. X., Ma, J.Y., Wang, D.X., Tang, A.N., Kong, D.M. (2021) Terminal deoxynucleotidyl transferase combined CRISPR-Cas12a amplification strategy for ultrasensitive detection of uracil-DNA glycosylase with zero background. Biosensors and Bioelectronics, 171, 112734. https://doi.org/10.1016/j.bios.2020.112734
• Grinstein, J.D. (2023). The Long and Winding Road: On-Demand DNA Synthesis in High Demand. GEN Biotechnology, 2(2). https://doi.org/10.1089/genbio.2023.29087.jdg
• Lu, X., Li, J., Li, C., Lou, Q., Peng, K., Cai, B., … Ma, Y. (2022). Enzymatic DNA Synthesis by Engineering Terminal Deoxynucleotidyl Transferase. ACS Catalysis, 12(5), 2988-2997. https://doi.org/10.1021/acscatal.1c04879
• Motea, E. A., & Berdis, A. J. (2010). Terminal deoxynucleotidyl transferase: the story of a misguided DNA polymerase. Biochimica et biophysica acta, 1804(5), 1151–1166. https://doi.org/10.1016/j.bbapap.2009.06.030
• Yoo, E., Choe, D., Shin, J., Cho, S., & Cho, B. K. (2021). Mini review: Enzyme-based DNA synthesis and selective retrieval for data storage. Computational and structural biotechnology journal, 19, 2468–2476. https://doi.org/10.1016/j.csbj.2021.04.057
• Hoitsma, N. M., Whitaker, A. M., Schaich, M. A., Smith, M. R., Fairlamb, M. S., & Freudenthal, B. D. (2020). Structure and function relationships in mammalian DNA polymerases. Cellular and molecular life sciences : CMLS, 77(1), 35–59. https://doi.org/10.1007/s00018-019-03368-y.
• Bollum, F. J. (1960) Calf Thymus Polymerase. The Journal of Biological Chemistry, 235, 2399–2403. https://pubmed.ncbi.nlm.nih.gov/13802334/
• Wang, G., He, C., Zou, J., Liu, J., Du, Y., & Chen, T. (2022). Enzymatic Synthesis of DNA with an Expanded Genetic Alphabet Using Terminal Deoxynucleotidyl Transferase. ACS synthetic biology, 11(12), 4142–4155. https://doi.org/10.1021/acssynbio.2c00456 https://doi.org/10.1021/acscatal.1c04879 (will list out the relevant primary references from this paper later)
• Xiang, B., He, K., Zhu, R., Liu, Z., Zeng, S., Huang, Y., Nie, Z., Yao, S. (2016) Self-Assembled DNA Hydrogel Based on Enzymatically Polymerized DNA for Protein Encapsulation and Enzyme/DNAzyme Hybrid Cascade Reaction. ACS Appl Mater Interfaces. 8(35), 22801-7. https://doi.org/10.1021/acsami.6b03572
• Hariri A., Newman S. S., Tan S., Mamerow D., Adams A. M., Maganzini N., Zhong B. L. Eisenstein M., Dunn A. R., Soh T. (2020) Improved immunoassay sensitivity and specificity using single-molecule colocalization. Nature communications. 13(5359). https://www.nature.com/articles/s41467-022-32796-x
• Pandey, V.; Modak, M.J. (1987) Purification of high molecular mass species of calf thymus terminal deoxynucleotidyltransferase. Prep. Biochem., 17, 359-377. https://www.tandfonline.com/doi/abs/10.1080/00327488708062502
• Ratliff, R.L. (1981) Terminal deoxyribonucleotidyl transferase The Enzymes, 3rd Ed. (Boyer, P. D. ,ed.), 14, 105-118. https://link.springer.com/chapter/10.1007/978-3-540-71526-9_36
• Grosse, F.; Manns, A. (1993) Terminal deoxyribonucleotidyl transferase, Methods Mol. Biol., 16, 95-105.