Part:BBa_K5508001
GAL1,10-HsLF-CYC1
The lactoferrin gene BBa_K5508000 from the Homo sapiens genome was inserted into the Saccharomyces cerevisiae expression plasmid pESC for lactoferrin production in Saccharomyces cerevisiae.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 960
- 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 960
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1375
Illegal BglII site found at 1499
Illegal BglII site found at 2486 - 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 960
- 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 960
Illegal NgoMIV site found at 2342
Illegal AgeI site found at 374 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 1839
Results
(1)Plasmid Construction
After synthesis of the codon-optimized sequence of HsLF by Gene Synthesis, we amplified it by PCR using primers 2HsLF-Gibson-F (CGACTCACTATAGGGCCCGGGGATGAAACTTGTTTTTTTTTTTAGTCTTAC)and HsLF-Gibson-R (GCTAGCCGCGGTACCAAGCTTTTAGTGGTGGTGATGGTGATG) for its PCR amplification.
After linearisation of the vector using SmaI and HindIII, we ligated the vector and target gene fragments using ClonExpress II One Step Cloning Kit, which was then transferred into E. coli DH5α competent cell and cultured in LB solid screening medium.
After 12h incubation at 37℃, we picked single colonies and performed colony PCR, for the strains that were verified to be correct, we sent them to a professional sequencing company to verify the correctness of their gene sequences, and the results were as follows:
After determining the correctness of the recombinant plasmid, we extracted the plasmid and transfected it into Saccharomyces cerevisiae BY4741 competent cells according to the method mentioned in the protocol, and transfected it into SD-URA solid medium for screening. We simultaneously transferred the pESC-URA plasmid into Saccharomyces cerevisiae as a control for subsequent validation experiments. Single colonies were successfully grown after 72 h of incubation at 30°C.
(3) SDS-PAGE
To test whether lactoferrin was successfully synthesized, following induction and fermentation, we extracted total protein from cells and examined it by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE).
Unfortunately, after SDS-PAGE, we did not see any obvious bands of lactoferrin appear.
(4)spectrophotometry
Due to the lack of more accurate testing equipment in our lab, we chose to measure the presence of lactoferrin in the fermentation broth using spectrophotometry. This utilises the principle that lactoferrin produces a specific absorption peak at 475 nm.
We used pESC-URA / BY4741 as a negative control to exclude measurement errors caused by metabolites in the medium and during fermentation of the strain. 48t hours after the addition of the inducer galactose, we measured the absorbance of the fermentation supernatant at 475 nm. As shown, the absorbance of pESC-HsLF/BY4741 was significantly increased compared to the negative control.
| None |