Part:BBa_K5317021
CMV-ATF2-mRuby2
Usage and Biology
ATF2 belongs to the ATF/CREB family (Kirsch et al., 2020) and its phosphorylation by PknB, making it important for research into signaling pathways related to cell stress and survival, while mRuby2 provides a fluorescent marker for visualisation. In our cell-based & #946;-lactam ring-containing antibiotics sensor, ATF2 serves as a translator of changes in PknB activity at the level of gene regulation, in particular the activity of the ATF2-3xCre2xAP1 promoter.
Cloning
Theoretical Part Design
We placed the mRuby2 fluorescent marker (K5317001) downstream behind ATF2 (K5317015). This gene was codon optimised for human cell lines.
Sequence and features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1398
Illegal EcoRI site found at 1660
Illegal XbaI site found at 1373
Illegal XbaI site found at 1701
Illegal PstI site found at 2108
Illegal PstI site found at 2557 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 670
Illegal SapI.rc site found at 2408
Cloning
Furthermore, the CMV promoter ensures robust expression in mammalian systems (Radhakrishnan et al., 2008) that can be easily detected and analysed. This composite part was engineered with NEBBuilder® HIFI assembly method. We linearized eGFP-C2 with BamHI and AseI inserting a linked ATF2 and mRuby seamlessly.his part was amplified by using the primers in table 1.
| Primer name | Sequence |
|---|---|
| ATF2_fw_1 | TGAACCGTCAGATCCGatgaaattcaagttacatgtgaattctgccag |
| ATF2_rv_2 | ggatccccacttcctgagggctgtgac |
| ATF2_fw_3 | caggaagtggggatccaccggtcg |
| ATF2_rv_4 | TCAGTTATCTAGATCCGGTGcttgtacagctcgtccatccc |
Characterisation
Transfection experiments in mammalian HEK293T cells assessed the promoter functionality, sensitivity and specifity. First, the composite part carrying plasmid was introduced via transfection to establish localisation of ATF2 before co-transfecting experiments with the CMV-PknB-EGFP carrying plasmid and CMV-ATF2-3xCre-API3x carrying plasmid (composite part K5317016). The mRuby fluorescence signal was analyzed for localization by microscopy and intensity by FACS analysis.
Single-transfection experiments
To find out the basal expression of ATF2, ATF2 was incubated individually and without stimulating environment. This shows that PknB is correctly localised in the cell and can be used for further experiments.
Figure 2: Single-transfected HEK293T cells with the ATF2-mRuby2-C2 plasmid depicted under unstimulated conditions. Scale bar = 20 µm.
The correct expression of ATF2-mRuby2 is shown in figure 2, where a cytoplasmatic localization in the cells is detectable. Therefore, we decided to use ATF2 as a crucial transfection factor to mediate between the PknB and the promoter. Therefore, we decided to use ATF2 as a crucial transfection factor to mediate between the PknB and the promoter. However, it is important to note that only small sample sections are presented here, and transfection efficiency may vary between treatments.
Co-transfection with PknB-EGFP
Double transfection shows that PknB and ATF2 do not inhibit each other's co-expression and can be used for further experiments with the promoter. Under stimulating conditions, both signals increase slightly.
Figure 3: The montage double-transfected CMV-PknB-eGFP and CMV-ATF2-mRuby2 in HEK cells with and without ampicillin stimulation.
The co-transfection (Figure 4) shows an image expressing HEK cells of CMV-PknB-eGFP and CMV-ATF2-mRuby2. Shown are brightfield (left), fluorescence channels for eGFP and mRuby2 and an overlay of the three channels with and without coloured signals (right).
Co-transfection experiments with PknB and ATF2-Cre3x-API3x
The parts ATF2-EGFP, PknB-mRuby2and ATF2-3xCre3xAP1-Promoter_miniCMV_miRFP670 were co-transfected into HEK cells, with and without stimulating conditions, to detect a significant effect. This is significant to see if our own promoter is actually recognised by the native ATF2 or the transfected ATF2 and to provide a statement on the functionality of our biosensor.
Figure 4: Representative microscopy image of HEK cells expressing EGFP-PknB, ATF2-mRuby2 and ATF2-3xCre3xAP1-Promoter_miniCMV_miRFP670. Shown are the fluorescence channels for eGFP, mRuby2 and miRFP670 (first three images from the left) and an overlay of the three channels (right). In a) is shown the basal activity of the promoter. In b) is shown the promoter activity after induction with 100 µg/mL ampicillin after four hours of incubation.
Shown HEK cells (Figure 4) co-transfected with our composite parts EGFP-PknB and ATF2-mRuby2 as well as our tested promoter-driven reporter. ATF2 expression is shown in red and the respective reporter miRFP670 expression, which indicated a basal promoter activity, in pink. Particularly noteworthy here is again the correct localization of the prokaryotic membrane protein PknB in the eukaryotic cell membrane, in green. To study whether the presence of beta-lactam antibiotics in the cell media will be sensed by PknB, leading to a phosphorylation of ATF2 and subsequently to an induction of our promoter-driven reporter fluorophore, we incubated co-transfected HEK293T cells with ampicillin (100 µg/mL) for four hours. This shows a higher fluorescent signal in our synthetic promotor compared to unstimulated conditions.
References
Kirsch, K., Zeke, A., Tőke, O., Sok, P., Sethi, A., Sebő, A., Kumar, G. S., Egri, P., Póti, Á. L., Gooley, P., Peti, W., Bento, I., Alexa, A., & Reményi, A. (2020). Co-regulation of the transcription controlling ATF2 phosphoswitch by JNK and p38. Nature Communications, 11(1), 5769. https://doi.org/10.1038/s41467-020-19582-3
Radhakrishnan, P., Basma, H., Klinkebiel, D., Christman, J., & Cheng, P.-W. (2008). Cell type-specific activation of the cytomegalovirus promoter by dimethylsulfoxide and 5-Aza-2’-deoxycytidine. The International Journal of Biochemistry & Cell Biology, 40(9), 1944–1955. https://doi.org/10.1016/j.biocel.2008.02.014
| None |