Composite
Part:BBa_K5317021
Designed by: Vanessa Bruhn Group: iGEM24_Hannover (2024-09-22)
CMV-ATF2-mRuby2
Usage and Biology
ATF2 belongs to the ATF/CREB family (Kirsch et al., 2020) and its phosphorylation by PknB, making it important for research into signaling pathways related to cell stress and survival, while mRuby2 provides a fluorescent marker for visualisation. In our cell-based & #946;-lactam ring-containing antibiotics sensor, ATF2 serves as a translator of changes in PknB activity at the level of gene regulation, in particular the activity of the ATF2-3xCre2xAP1 promoter.
Cloning
Theoretical Part Design
We placed the mRuby2 fluorescent marker (K5317001) downstream behind ATF2 (K5317015). This gene was codon optimised for human cell lines. This part was amplified by using the primers in table 1.
Primer name | Sequence |
---|---|
ATF2_fw_1 | TGAACCGTCAGATCCGatgaaattcaagttacatgtgaattctgccag |
ATF2_rv_2 | ggatccccacttcctgagggctgtgac |
ATF2_fw_3 | caggaagtggggatccaccggtcg |
ATF2_rv_4 | TCAGTTATCTAGATCCGGTGcttgtacagctcgtccatccc |
Sequence and features
No part name specified with partinfo tag.
[edit]
Categories
Parameters
None |