Part:BBa_K5267004
P_4xCRE
As the response element to report whether melatonin is accepted or not Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 88
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Profile
Name: 4xCRE-Pmin
Base Pairs: 117bp
Origin: Homo sapiens
Properties: As the response element to report whether melatonin is accepted or not
Usage and Biology
CRE(cAMP response element)play an important role as the binding site of CREB(cAMP response element binding protein) ,which is typically found within 100 nucleotides of the TATA Box. CREB binds to cAMP response elements and recruits transcriptional coactivators (such as CBP/p300) to form transcription complexes that initiate transcription of target genes.[1]
TATA Box is one of the components that constitute the promoter of eukaryotes. The consistent order is TATA(A/T)A(A/T) (non-template chain sequence). It is about -30bp (-25~-32bp) upstream of the transcription starting point of most eukaryotic genes, and is basically composed of A-T base pairs, which determines the selection of gene transcription and is one of the binding sites of RNA polymerase. RNA polymerase can only start transcription after firmly binding to the TATA Box. The ability of CRE sequences to mediate transcriptional activation in response to cAMP appears to be somewhat promoter dependen[1],in this experiment, TATA box of the commonly used CMV promoter was selected to minimize to the minimum amount of nucleotides for transcription and named Pmin.
The activity of CREB is modulated by a plethora of signaling cascades, including three downstream pathways that are activated by the melatonin receptor MT1/2 in response to melatonin stimulation: the cAMP/PKA pathway, the calcium (Ca2+) signaling pathway, and MAPK/ERK pathway.[2] Consequently, CRE can be employed as a diagnostic element to assess the successful activation of the melatonin receptor's downstream signaling pathways.
Special design
This basic part is an important element for testing whether the downstream pathway of melatonin responds successfully. At present, the commonly used method to study the signaling pathway is to clone the response element of the transcription factor corresponding to the signaling pathway into the luciferase reporter gene vector, that is, pCRE-luc .[3] However, the expression effect of a single responder is weak，so multiple tandem repeats of the same responder element are usually inserted upstream of the reporter gene (the 5 '-UTR region) to enhance the activation of the signaling pathway. By searching through literature, we constructed the 4xCRE-Pmin sequence，It contains a 5′ minimal promoter incorporating 4 multimerized palin-dromic CREs with the sequence 5′-AGCC[TGACGTCC]GAG-3′. (CRE denoted in brackets)，with the exception of a single nucleotide substitution (C for A) within the CRE[4]，which may strengthen gene expression downstream.
Function test
In order to test the function of cAMP response element, multiple CRE sequences and Pmin were loaded onto vector that equipped with sleeping beauty transposon site, where IgK-Nluc reporter gene added downstream. If the incandescent sequence responds successfully, the Nluc gene will be successfully expressed. (Figure 1)
In Figure 1,we can find that the expression level of Nluc gene in cells supplemented with 4XGRE-Pmin was significantly increased compared with the blank control, which proved that the CRE sequence responded successfully.
Sequence
agcctgacgtccgagagccgtagcctgacgtccgagggtaccagcctgacgtccgagagccgtagcctgacgtccgagtactccgtagaggg
tatataatggaagctcgacttccag
Reference
[1] M. Montminy, "Transcriptional regulation by cyclic AMP," Annu Rev Biochem, vol. 66, pp. 807-22, 1997, doi: 10.1146/annurev.biochem.66.1.807.
[2] A. J. Shaywitz and M. E. Greenberg, "CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals," Annu Rev Biochem, vol. 68, pp. 821-61, 1999, doi: 10.1146/annurev.biochem.68.1.821.
[3] C. Kemmer, D. A. Fluri, U. Witschi, A. Passeraub, A. Gutzwiller, and M. Fussenegger, "A designer network coordinating bovine artificial insemination by ovulation-triggered release of implanted sperms," J Control Release, vol. 150, no. 1, pp. 23-9, Feb 28 2011, doi: 10.1016/j.jconrel.2010.11.016.
[4] O. G. Chepurny and G. G. Holz, "A novel cyclic adenosine monophosphate responsive luciferase reporter incorporating a nonpalindromic cyclic adenosine monophosphate response element provides optimal performance for use in G protein coupled receptor drug discovery efforts," J Biomol Screen, vol. 12, no. 5, pp. 740-6, Aug 2007, doi: 10.1177/1087057107301856.
| None |