RNA

Part:BBa_K5375006

Designed by: BOHAN REN   Group: iGEM24_Keystone   (2024-09-23)
Revision as of 11:05, 25 September 2024 by Baldeep (Talk | contribs)

siHSP70-1



Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Origin

Synthesized by company.

Properties

Inhibition of Heat Shock Protein 70 expression.

Usage and Biology

siHSP70-1 inhibits the target gene HSP70 as a small interfering RNA (siRNA). HSP70 can induce IgE-mediated hypersensitivity reactions and T-cell responses in allergic individuals (Fagotti et al., 2022). Further discussion of it as a pan-allergen can be found in part BBa_K2619011. siRNA is a key component of the RNAi process, a powerful gene silencing mechanism. Once introduced into the target cells, it is recognized and loaded into the RNA-Induced Silencing Complex (RISC). The siRNA’s antisense strand binds to the complementary target mRNA molecule, triggering the RISC complex into cleaving the target mRNA. This prevents the target mRNA from being translated into a functional protein (Agrawal et al., 2003). The silencing effect typically lasts around 12 days for this part.

Its potential lies in applications to plant cells, where it successfully inhibits the expression of the pan-allergen HSP70, alleviating and reducing allergic symptoms for *Populus tomentosa* pollen allergy.

Cultivation and Purification

siHSP70-1 is cultivated through oligonucleotides with a nucleic acid synthesizer. Two complementary oligonucleotides are chemically synthesized, representing the sense and antisense strands of the siRNA:

- Oligo Sequence for siHSP70-1-SS: CCUUCAAGGUCAUCGAGAAGG - Oligo Sequence for siHSP70-1-AS: UUCUCGAUGACCUUGAAGGGG

The oligonucleotides are then mixed under appropriate buffer conditions to anneal and form a double-stranded siRNA molecule. The resulting siRNA is purified using high-performance liquid chromatography (HPLC) (Sohail et al., 2003). To enhance siRNA delivery into plant cells, carbon dots (CDs) were incorporated with Polyethyleneimine (PEI) through the microwave method, allowing the negatively charged siRNA to bind to the CDs via electrostatic adsorption.

Measurement and Characterization

RT-qPCR results for protoplasts
Figure 1. RT-qPCR results for protoplasts.

The chart shows the performance of siHSP70-1 in inhibiting HSP70 expression. Results indicate that siHSP70-1 was unable to repress HSP70 and caused minor fluctuations. Thus, siHSP70-1 was deemed unsuccessful, while siHSP70-2 and -3 demonstrated better performance.

RT-qPCR results for tobacco leaf injection
Figure 2. RT-qPCR results for tobacco leaf injection.

RT-qPCR results for siRNA injection in tobacco leaves. siHSP70-1 and CDs@siHSP70-1 columns indicate the performance of siHSP70-1. Data shows that combining siHSP70-1 with CDs was unsuccessful in repressing HSP70 expression.

RT-qPCR results for osmanthus tree trunk injection
Figure 3. RT-qPCR results for osmanthus tree trunk injection.

RT-qPCR results for siRNA delivery through trunk injection in osmanthus trees. Some success in inhibiting HSP70 expression was observed with the combination of CDs, but further trials are required to validate the efficacy.

Further trials and improvements will be needed for siHSP70-1 to ensure optimal quality and efficacy in target gene repression.

Reference

Agrawal N. N., Dasaradhi P. V., Mohmmed A., Malhotra P., Bhatnagar R. K., & Mukherjee S. K. (2003). RNA Interference: Biology, Mechanism, and Applications. *Microbiology and Molecular Biology Reviews*, 67(4), 657-685. [1](https://doi.org/10.1128/MMBR.67.4.657-685.2003)

Fagotti A., Lucentini L., Simoncelli F., La Porta G., Brustenga L., Bizzarri I., Trio S., Isidori C., Di Rosa I., & Di Cara G. (2022). HSP70 upregulation in nasal mucosa of symptomatic children with allergic rhinitis and potential risk of asthma development. *Scientific Reports*, 12(1), 1-10. [2](https://doi.org/10.1038/s41598-022-18443-x)

Sohail M., Doran G., Riedemann J., Macaulay V., & Southern E. M. (2003). A simple and cost-effective method for producing small interfering RNAs with high efficacy. *Nucleic Acids Research*, 31(7), e38.

[edit]
Categories
Parameters
None