Part:BBa_K5317007

Murine MTF-1 gene

Usage and Biology

The Metal Regulatory Transcription Factor 1 (MTF-1) is a metal ion-sensing transcription factor, regulating primarily zinc, cadmium and copper homeostasis and detoxification (Tavera-Montañez et al. 2019, Wimmer et al. 2005). Activation of MTF-1 due to increasing levels of heavy metals in the cytoplasm results in its translocation into the nucleus and binding via its zinc finger domains to MREs, specifically consensus TGCRCNC in promoter regions of the DNA. Thereby MTF-1 regulates expression of metallothioneins, metal transporters and antioxidant genes as protection against metal toxicity and oxidative stress (Tavera-Montañez et al. 2019). Additional stimuli of MTF-1 nucleus import are stress signals like e.g. heat shock, H2O2, low extracellular pH (Saydam et al. 2001).

Cloning

Theoretical Part Design

This basic part contains the mammalian MTF-1 transcript, which was amplificated from murine fibroblast NIH3T3 cDNA by using the Primers in table 1.

Table1: Primers used to design the fragments.

Primer name	Sequence
MTF1_fw	CAGAGCTGGTTTAGTGAACCGTCAGATCCGATGGGGGAACACAGTCCAGAC
MTF1_rv	gatcccccCTAGGGTGGCAGCTGCAG

===Sequence and Features=== BBa_K5317007 SequenceAndFeatures =References= Saydam, N., Georgiev, O., Nakano, M. Y., Greber, U. F., & Schaffner, W. (2001). Nucleo-cytoplasmic trafficking of metal-regulatory transcription factor 1 is regulated by diverse stress signals. The Journal of biological chemistry, 276(27), 25487–25495. https://doi.org/10.1074/jbc.M009154200 Tavera-Montañez, C., Hainer, S. J., Cangussu, D., Gordon, S. J. V., Xiao, Y., Reyes-Gutierrez, P., Imbalzano, A. N., Navea, J. G., Fazzio, T. G., & Padilla-Benavides, T. (2019). The classic metal-sensing transcription factor MTF1 promotes myogenesis in response to copper. FASEB journal: official publication of the Federation of American Societies for Experimental Biology, 33(12), 14556–14574. https://doi.org/10.1096/fj.201901606R Wimmer, U., Wang, Y., Georgiev, O., & Schaffner, W. (2005). Two major branches of anti-cadmium defense in the mouse: MTF-1/metallothioneins and glutathione. Nucleic acids research, 33(18), 5715–5727. https://doi.org/10.1093/nar/gki881