Composite
MaSp1-Cp19

Part:BBa_K5143003

Designed by: Jess Philippon   Group: iGEM24_UnivLyon1-INSALyon   (2024-07-28)
Revision as of 15:59, 29 July 2024 by Jesslyon (Talk | contribs)

Description : MaSp1-Cp19k is a fused protein that can be used as a bioglue. It is the result of a fusion between a spider silk protein (MaSp1) and the barnacle cement protein (Cp19k). The adhesion ability of cp19k-MaSp1 was higher than that of individual proteins. Adhesion strenght : 39.9.7 mJ/m²


Construction : The codons were optimised for synthesis and expression in Saccharomyces cerevisiae. MaSp1 and Cp19k are fused with the GS linker : GGGGGTGGTGGTTTGGAAAGTGGAGGAGGTGGAAGT This composite part is part of the following larger composite part: put name composite part It was synthesized in its entirety and then cloned via PCR into the following plasmid: BBa_K5143005


References : Ye L, Liu X, Li K, Li X, Zhu J, Yang S, Xu L, Yang M, Yan Y, Yan J. A bioinspired synthetic fused protein adhesive from barnacle cement and spider dragline for potential biomedical materials. Int J Biol Macromol. 2023 Dec 31;253(Pt 5):127125. doi: 10.1016/j.ijbiomac.2023.127125. Epub 2023 Sep 28. PMID: 37776922.

[edit]
Categories
Parameters
None