Part:BBa_K5133004
sfGFP generator for CFPS (cell-free protein synthesis)
Group: GEC-China (iGEM 2024, team number: #5133)
Introduction
This composite part is derived from plasmid pJL1 (Addgene: #69496)[1], consisting of four basic parts: T7 promoter (BBa_K5133000), ribosome binding site (RBS, BBa_K5133001), coding sequence of superfolder green fluorescent protein (sfGFP, BBa_K5133002), and T7 terminator (BBa_K5133003)(Figures 1, 2). The plasmid pJL1 is commonly used for the in vitro sfGFP expression of cell-free protein synthesis (CFPS)[2], however, an iGEM-standarized CFPS construction has not yet been commonly reported and characterized yet. Hence, this part is established to demonstrate the feasibility of CFPS in our project.
Results
For the characterization process of this part, follow five steps showing in Figure 3: (1) molecular cloning; (2) colony PCR; (3) sequencing; (4) plasmid extraction; (5) CFPS reaction.
Step 1: molecular cloning
To construct this part, we first need to aquire the linearized DNA fragments of both vector and inserted fragments. Thus, we amplified vector pSB1C3 and inseted fragment (from plasmid pJL1) using PCR. Results of agarose gel electrophoresis showing the desired DNA bands (Figure 4) as pSB1C3 (2070 bp) and inserted fragment (988 bp).
Usages
This part is used for the construction of composite part BBa_K5133004 (sfGFP generator) to demonstrate the feasibility of CFPS in our project. Please see the detailed experimental results in BBa_K5133004.
DNA sequence (from 5' to 3')
atgagcaaaggtgaagaactgtttaccggcgttgtgccgattctggtggaactggatggcgatgtgaacggtcacaaattcagcgtgcgtggtgaaggtgaaggcgatgccacgattggcaaactgacgctgaaattt atctgcaccaccggcaaactgccggtgccgtggccgacgctggtgaccaccctgacctatggcgttcagtgttttagtcgctatccggatcacatgaaacgtcacgatttctttaaatctgcaatgccggaaggctat gtgcaggaacgtacgattagctttaaagatgatggcaaatataaaacgcgcgccgttgtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcacggattttaaagaagatggcaatatcctgggc cataaactggaatacaactttaatagccataatgtttatattacggcggataaacagaaaaatggcatcaaagcgaattttaccgttcgccataacgttgaagatggcagtgtgcagctggcagatcattatcagcag aataccccgattggtgatggtccggtgctgctgccggataatcattatctgagcacgcagaccgttctgtctaaagatccgaacgaaaaaggcacgcgggaccacatggttctgcacgaatatgtgaatgcggcaggt attacgtggagccatccgcagttcgaaaaataa
Red font: Strep-Tag II, from pJL1[1]
References
[1] https://www.addgene.org/69496/
[2] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 51
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 51
- 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 51
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 32
None |