Part:BBa_K5133005
Microcin H47
Group: GEC-China (iGEM 2024, team number: #5133)
Brief introduction
This basic part is derived from plasmid pFB399[1], including a DNA sequence for coding Microcin H47, an antimicrobial peptide produced by probiotic E. coli Nissle 1917. By assembling with T7 promoter (BBa_K5133000), RBS (BBa_K5133001), and T7 terminator (BBa_K5133003) derived from plasmid pJL1[2], this part is used for the construction of composite part BBa_K5133006 to demonstrate the in vitro production of antimicrobial peptides by CFPS.
Design and characterization
The plasmid design of this biological part is shown as Figure 1, assembled with iGEM standard backbone pSB1C3. To validate the correctness of DNA sequence, result of Sanger sequencing for BBa_K5133006 show the successful assembly among T7 promoter (BBa_K5133000), RBS (BBa_K5133001), Microcin H47 (this part), and T7 terminator (BBa_K5133003) in Figure 2.
Usages
This part is used for the construction of composite part BBa_K5133006 (Microcin H47 generator) to demonstrate the feasibility of in vitro antimicrobial peptide production by CFPS in our project.
DNA sequence (from 5' to 3')
atgcgagaaataacagaatcacagttaagatatatttccggggcgggaggtgcgccagcgacttcagctaatgctgcaggtgctgcagctattgttggagctctcgccggaatacctggtggtccacttggggttgta gttggagccgtatctgccggtttgacaacagcaattggctcgaccgtgggaagtggtagtgccagttcttctgctggtggcggtagccatcatcatcatcatcactaa
Red font: 6×His-Tag, for the detection by Western-Blot analysis
References
[1] Ba, F. et al. Expanding the toolbox of probiotic Escherichia coli Nissle 1917 for synthetic biology. Biotechnology Journal 19, 2300327 (2024). doi: 10.1002/biot.202300327
[2] https://www.addgene.org/69496/
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 74
Illegal PstI site found at 83 - 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 74
Illegal PstI site found at 83 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 74
Illegal PstI site found at 83 - 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 74
Illegal PstI site found at 83 - 1000COMPATIBLE WITH RFC[1000]
None |