Ptrc-sfp-MmCAR(Q302E)-SpyTag-EutM-SpyCatcher-YahK

The amino acid of MmCAR at 302 position was mutated from glutamine to glutamic acid. EutM scaffold was also used for further improving the part activity. 82.5 mM 1,5-PDO was produced by the cells that expressed this part, which is 1.89-fold higher than the wild type control.

Adaptation of the original part in cell factory

The existing part BBa_K1655000 contains carboxylate reductase (CAR) and its activation protein of sfp. By reading literature and consulting experts in related fields, we found that CARs could catalyse a broad spectrum of carboxylic acids into the corresponding aldehydes. Combined with our own project requirements, we tested its activity to catalyze a C5 carboxylic acid of 5-hydroxyvalerate with a final goal used for the 1,5-pentadiol(1,5-PDO) production.
The existing part BBa_K1655000 contains the promoter T7, which only can be adapted to strains containing the lambda DE3 lysogen. As the results shown in Figure 1, when we synthesized the part BBa_K1655000, ligated it into the plasmid of pRSFDuet, and transformed it into Escherichia coli BL21 without the lambda DE3 lysogen, the ability of the part to catalyze 5-hydroxyvalerate was not detected.
The chassis of E. coli NT1003 we engineered for 1,5-PDO production is also a strain that does not carry the lambda DE3 lysogen. Therefore, to make the part expression efficiently in the chassis, the promoter in the part was required to be changed. As we just need to employ the components of CAR and sfp in BBa_K1655000 for 1,5-PDO production, a trc promoter was added between YciA and RBS of sfp. The new fragments were subcloned into the plasmid pRSFDuet and transformed into the strain of E. coli BL21 without the lambda DE3 lysogen to evaluate its activity. As the product of 5-hydroxypentanal generated by CAR is not stable. Aldehyde reductase (YahK) that converts 5-hydroxypentanal to 1,5-PDO was also ligated into the plasmid pRSFDuet for a co-expression to evaluate activity by detecting the bioconversion of 5-hydroxyvalerate to 1,5-PDO in a whole-cell process. As the results shown in Figure 1, when the CAR and sfp were expressed under the control of trc promoter in E. coli BL21, we successfully detected the 5-hydroxyvalerate consumption and 1,5-PDO production. After reaction of 6 h, 63.2 mM 5-hydroxyvalerate was consumed and 48.9 mM 1,5-PDO was synthesized. These results indicated that the sfp and CAR components in part BBa_K1655000 also exhibited the ability to catalyze C5 5-hydroxyvalerate. We successfully expanded the application scenarios of the part BBa_K1655000.

Figure 1. (a) Adding the trc promoter in the part. (b) Determining the activity of the part under the control of different promoter in E. coli by detecting 1,5-PDO production. (c) Determining the activity of the part under the control of different promoter in E. coli BL21 by detecting 5-hydroxyvalerate consumption.

Improvement of the original part in work efficient

Introduction

After expanding the application scenarios of BioBrick BBa_K1655000 on 1,5-PDO production, we hope to further improve its ability to work more efficiently in E. coli by using optimised related components. We supposed that its activity to catalyze 5-hydroxyvalerate to generate 1,5-PDO could be increased through designing mutation or assembly of key component CAR enzyme. For this,the improving of BioBrick BBa_K1655000 are divided into two sections as follows: (i) the designing of CAR mutation; (ii) the assembly of CAR by a self-assembling protein scaffold system.

Design

We designed CAR mutation with higher activity by employing a rational engineering strategy. In combination with protein structure simulation and molecular autodock, the amino site of Q302 was identified to mutant it to E302 for changing the polarity of the residues. We designed point mutation primers Q302E-F(5’GGCCGTGAAATTCTGTATGGCACCCTGTGT) and Q302E-R(5’CAGAATTTCACGGCCCATCACATGACTCAT) and constructed the mutant MmCAR^Q302E, which was employed to replace the wild-type CAR in part. The mutant fragments were also subcloned into the plasmid pRSFDuet coupled with the co-expression of YahK, which was then transformed into the strain of E.coli BL21 without the lambda DE3 lysogen to evaluate its activity towards the bioconversion of 5-hydroxyvalerate to 1,5-PDO by a whole-cell process.
Subsequently, the part containing mutant CAR was further optimized by the enzyme assembly strategy. For the assembly of mutant CAR in vivo, a protein scaffold of EutM from Salmonella enterica was employed and the SpyTag-SpyCatcher system is also used to help MmCAR and EutM bind better. In detail, the laboratory conserved plasmid pETDuet-T7-EutM-SpyCatcher was used as a template to clone and overlap the fragments of EutM and SpyCatcher by PCR with a trc promoter and RBS. The MmCAR^Q302E-Spytag fragment was obtained by adding the Spytag sequence at the 5' end of the primer, and then cloned MmCAR^Q302E by PCR. All the fragments were attached by homologous recombination to construct composite part. The above part was ligated into the vector of pRSFDuet coupled with the co-expression of YahK, which was then transformed into the strain of E.coli BL21 without the lambda DE3 lysogen to evaluate its activity towards the bioconversion of 5-hydroxyvalerate to 1,5-PDO by a whole-cell process.In order to facilitate the use by the other teams, we have registered the final optimized composite component with the number BBa_K4800008. The optimization comparing with the original part BBa_K1655000 (Figure 2).

Figure 2. The design of the optimized part

Results

As the results shown in Figure 3, when the amino acid at 302 position was mutated from glutamine to glutamic acid, the activity of the part to consume 5-hydroxyvalerate was increased by 22.3% and the activity to produce 1,5-PDO was increased by 51.2%. The assembly of CAR by EutM scaffold further improve the part activity. After reaction of 6 h in a whole cell bioconversion process, 89.5 mM 5-hydroxyvalerate was consumed by the cells that expressed part containing CAR mutation, which is 1.56-fold higher than the wild type control. Correspondingly, 82.5 mM 1,5-PDO was produced by the cells that expressed part containing CAR mutation and EutM scaffold, which is 1.89-fold higher than the wild type control.

Figure 3. Determining the activity of the optimized part by detecting 1,5-PDO production and 5-hydroxyvalerate consumption in comparison to the wild type part in a whole cell catalysis process

Usage of the optimized part

What is more, focusing on the practical application of the final optimized composite component, it was applied engineer E. coli for 1,5-PDO production from glucose. The optimized part BBa_K4800008 was ligated into the vector of pRSFDuet coupled with the co-expression of YahK to obtain plasmid pRSFDuet-sfp-MmCAR^Q302E-SpyTag-EutM-SpyCatcher-YahK, which was transformed into the engineered E. coli NT1003-ΔYcjQ together with 5-hydroxyvalerate synthesis module from lysine (pTrc99a-davB-davA-GabT). The obtained strains were cultivated in fermenting medium supplemented with 20 g/L glucose. As the results shown in Figure 4, the engineered strain NT1003-P2-ΔYcjQ expressing the original part produced 13.6 mM (1.41 g/L) 1,5-PDO from glucose, while the optimized part made the 1,5-PDO production in the strain of NT1003-P4-ΔYcjQ increased by 70%, and 23mM (2.4 g/L) of 1,5-PDO was finally achieved.

Figure 4. The usage of the optimized part for 1,5-PDO production from glucose

In summary, we have expanded and enhanced the catalytic efficiency of BBa_K4800008, proving the authenticity of our strategy and component improvement.

Sequence and Features

Assembly Compatibility: