Composite
Part:BBa_K4743006:Design
Designed by: Jen Hsien, Liu Group: iGEM23_PTSH-Taiwan (2023-09-16)
PnuC-GFP-Pm associated sequence
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1761
Illegal XbaI site found at 484 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1761
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1761
Illegal BglII site found at 88
Illegal BamHI site found at 16
Illegal XhoI site found at 682
Illegal XhoI site found at 1408 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1761
Illegal XbaI site found at 484 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1761
Illegal XbaI site found at 484
Illegal AgeI site found at 1774 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
[1]AAGGTACCGCAGGTGGGATCC is the forward primer of Adapter 1
TCACCGGTGCAGGTGGAATTC is the reverse primer of Adapter 2
Also, BamHI is included in adapter 1 and EcoRI is included in Adpater 2. These two site can be used for cloning
[2] We put GFP and Plasma membrane associated sequence intend to check if the transporter pnuC is on the plasma membrane.
Source
Salmonella enterica
References
1. Black, W.B., Aspacio, D., Bever, D. et al. Metabolic engineering of Escherichia coli for optimized biosynthesis of nicotinamide mononucleotide, a noncanonical redox cofactor. Microb Cell Fact 19, 150 (2020). https://doi.org/10.1186/s12934-020-01415-z