Part:BBa_K4768000

DhdR repressor

Part for expression and purification of our transcriptional repressor DhdR for biosensing.

Sequence and Features

Assembly Compatibility:

• 10
  INCOMPATIBLE WITH RFC[10]

  Illegal XbaI site found at 47
  
• 12
  COMPATIBLE WITH RFC[12]
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BglII site found at 493
  Illegal BglII site found at 622
  
• 23
  INCOMPATIBLE WITH RFC[23]

  Illegal XbaI site found at 47
  
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal XbaI site found at 47
  
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal BsaI.rc site found at 756
  

xxxxxxxxxxxxxxxxxxadd part imagexxxxxxxxxxxxx

Introduction

The CALIPSO part (BBa_K4768000) consists of the transcriptional repression factor, DhdR, which has been isolated from the bacterium Achromobacter denitrificans. The codon sequence has been optimized for expression in E.coli. Additionally, the presence of a T7 promoter and terminator enables its inducible expression by IPTG in E.coli BL21 (DE3). Finally, a Histidine tag is included in the sequence to facilitate the purification of DhdR.

This transcriptional repressor was employed in our biosensing system, which was inspired by the work of Ping Xu et al. ₁ and the work conducted by iGEM Duke 2021. Our objective was to use the affinity between 2-Hydroxyglutarate, an oncometabolite, and DhdR to trigger the production of our drug-activating enzyme when liposomes are situated in a tumoral environment. To achieve this, we positioned our gene of interest under the control of the operator site of DhdR, referred to as dhdO.

Figure 1: Operating principle of our biosensor.In presence of 2-HG, repression is removed and the gene is expressed leading to the production of the thymidine phosphorylase which converts the Tegafur prodrug into an active anticancer drug, 5-fluorouracile.

Construction

The CALIPSO part BBa_K4768000 comprises the transcriptional repression factor DhdR fused with a histidine tag at its N-terminus. The synthesis of this gBlock was performed and provided by IDT.

The gBlock was then cloned into the pET_21a(+) plasmid and transformed into Stellar competent cells.

Primers used to clone this part in the pET21: (from 5' to 3'):

• DhdR-pET21-F: AGCAGCCGGATCTCATCATGACGTCTGACGCGC
• DhdR-pET21-R: GAAGGAGATATACATATGGGCCATCATCATCATCATC

Figure 2 shows the enzymatic restriction pattern of the resulting clones. Clone 4 was digested using EcoRV and NdeI. Two bands were expected at 1.3 kb and 4.8 kb, as experimentally measured (lane 5).

Figure 2: Enzymatic digestion of the plasmid partextracted from clone 4. Patterns from simple digestion by EcoRV or by NdeI, and double digestion by both enzymes are shown.

Clone 4 was sequence verified.

Characterization

1) Production and purification of DhdR

The pET21a(+) vector including the dhdR insert was transformed into E.coli strain BL21 (DE3). This strain was provided by Cédric Montanier (researcher at TBI). When DO reaches 0.5-0.6, expression of the recombinant protein was induced overnight at 16°C using IPTG. The His-tagged protein was then purified on TALON® Metal Affinity Resin. Pure fractions were assessed by SDS-PAGE.Results are shown in Figure 3.

Figure 1: SDS-PAGE analysis of the different steps of the DhdR purification: protein ladder (SE250 Mighty Small II Mini Vertical Protein Electrophoresis Unit), pellet DhdR, cell-free extract (CFE), flowthrough (FT), wash (W), elution with 50 mM imidazole, 100 mM imidazole, 250 mM imidazole and 500 mM imidazole (respectively E1₅₀, E1₁₀₀, E1₂₅₀ and E1₅₀₀). The band corresponding to the protein was clearly identified by Coomassie Blue staining.

The expected size for DhdR is 28.27 kDa. Clear bands were observed for the four elution fractions E1₅₀, E1₁₀₀, E1₂₅₀ and E1 500, but not in the negative control sample, as expected. These data show that DhdR was efficiently purified and can be used for subsequent assays.

The E1₂₅₀ fraction was dialysed leading to a concentration of 14.4 µM (> 95% pure protein). Fractions E1₁₀₀ and E1₅₀₀ were pooled and dialysed, resulting in a concentration of 7.63 µM (> 95% pure protein).

2) Functionality tests in PURE system

The aim of our experiments was to establish that the binding of the repressor DhdR to its operator site, dhdO, effectively inhibits transcription of a gene of interest regulated by dhdO. Then, we wanted to show that the presence of 2-HG leads to the de-repression of that gene in PURE system.

Inhibition was tested on the sfgfp reporter gene by fluorescence measurements. To determine the minimal concentration of DhdR required to obtain strong repression, sfGFP was synthesized in the presence of different concentrations of DhdR. Our biochemical network model predicted a range of DhdR concentrations expected to lead to different sfGFP levels, which we experimentally tested.

Figure 4: Effect of different concentrations of DhdR on the expression of a fluorescent reporter gene. Experiments 1 and 2 were performed with the same batch of PCR product from clone 8, while a new batch of PCR product from the same clone was used in experiment 3. PUREfrex2.0 was used in all conditions. The intensity value of sfGFP without DhdR was used for normalization. Excitation and emission wavelengths were 488 nm and 510 nm, respectively.

As expected, the higher the concentration of DhdR, the stronger the repression in all three experiments (Figure 4). With the new batch of linear DNA, repression was consistently stronger. We deduced from these results that the optimal concentration of DhdR to efficiently repress expression of a gene under transcriptional control of a dhdO operator sequence was 1.5 µM, validating the predictions of the biochemical network model.

Induction of gene expression that was repressed by 1.5 µM of DhdR was then assayed using physiological concentrations of 2-HG found around tumor cells, i.e., between 10 and 100 µM. A higher concentration was also tested, corresponding to full saturation of the DhdR repressor. The results demonstrate that 2-HG de-represses transcription of DhdR-bound DNA in a concentration-dependent manner (Figure 5). Up to 48% of sfGFP signal was recovered at a saturating concentration of 2-HG. The reason why protein production is not fully restored remains to be investigated.

Figure 4: Effect of different concentrations of 2-HG on DhdR repression. PUREfrex2.1 was used. The intensity value of sfGFP without DhdR and with 10 µM 2-HG was used for normalization. Each concentration was corrected taking into account the inactivation effect of 2-HG on PURE system.

3) In-liposome expression of the sfgfp gene

• - DhdR repression in liposomes

Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, either with 1.5 µM of DhdR or without DhdR. Liposomes were imaged by optical microscopy.

Figure 6a displays a population of liposomes localized by the membrane dye Topfluor594. A zoom-in image of liposomes showed the fluorescent rim characteristic of membrane-labeled vesicles (Fig. 6b). The line intensity profile generated with ImageJ confirmed that the intensity was higher at the membrane and lower inside the liposome (Fig. 6c).



Figures 6: a) Liposomes were localized with a fluorescent membrane dye. b) Zoom-in image of the liposome area depicted with a red arrow in a. A yellow line crossing the liposome has been appended. c) Fluorescence intensity profile along the line appended in b. The two peaks correspond to the two regions of membrane crossing.

Figure 7a displays a population of liposomes expressing the sfGFP gene. In the liposome shown in Fig. 7b, one can clearly see the distribution of GFP fluorescence inside the lumen of the liposome. A quantitative analysis is represented in Fig. 7c. Analysis of the two samples with or without DhdR did not reveal notable differences neither in the occurrence of liposomes exhibiting GFP nor in the intensity level of GFP inside individual liposomes.



Figure 7: Fluorescence microscopy image of liposomes in the GFP channel. Expressed sfGFP signal was localized in the liposome lumen. a) Large field-of-view. b) Blow-up of the liposome depicted with the red arrow in a. c) Intensity profile along the yellow line appended in b.

• - Liposomes are capable of expressing GFP in the presence of living cancer cells

Two experiments were conducted in which the PURE system solution was encapsulated in liposomes along with the sfgfp gene, Tegafur and 1.5 µM of DhdR. Liposomes were also coated with anti-HER2-nb and folate ligands. Two conditions were tested for exposing liposomes to Caco-2 cancer cells. In the first protocol, liposomes were incubated in a thermocycler for gene expression prior to their functionalization with anti-HER2-nb and injection on top of cancer cells (sample 1). In a second protocol, liposomes pre-coated with anti-HER2-nb were injected in the growth medium on top of Caco-2 cells, where they have been incubated for in situ gene expression (sample 2). The latter protocol more closely mimics the in vivo conditions for drug delivery. Fluorescence microscopy was used to image living cells, liposomes and sfGFP expression.

In sample 1, in the field of view displayed in Figure 8, two liposomes were localized using the fluorescent membrane dye (Fig. 8b) but only one exhibits sfGFP signal (Fig. 8c).



Figure 8: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 1). a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of liposomes localized with a fluorescent membrane dye. c) Imaging of liposomes in the GFP channel.

Similar results were obtained with sample 2, as shown in Figure 9.



Figure 9: Fluorescence microscopy images of anti-HER2-nb- and folate-decorated liposomes on top of Caco-2 cells (sample 2).a) Imaging of Caco-2 cells in the Brightfield channel. b) Imaging of a liposome localized with a fluorescent membrane dye. c) Imaging of the same liposome in the GFP channel.

No difference was observed between liposomes incubated at 37°C and those incubated directly on cancer cells. In both cases, we obtained some liposomes able to produce sfGFP. Follow-up experiments will be necessary to ascertain that gene expression was enabled by 2-HG and not by insufficient repression by DhdR. For instance, optimizing the relative and absolute amounts of DNA and DhdR in liposomes will allow for a better discrimination between repressing and non-repressing conditions.

Molecular Modeling

TXXXXXX.

Characterisation

TXXXXXX.

Conclusion and Perspectives

TXXXXXX.

References

1. article 1 xxxxxxxx
2. article 2 xxxxxxx