Part:BBa_K4768003

Recombinant human Thymidine Phosphorylase (TYMP)

Biosensing inducible system to express human thymidine phosphorylase in PURE system

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal BamHI site found at 1536
  Illegal XhoI site found at 1531
  
• 23
  COMPATIBLE WITH RFC[23]
• 25
  INCOMPATIBLE WITH RFC[25]

  Illegal NgoMIV site found at 1407
  
• 1000
  COMPATIBLE WITH RFC[1000]

Introduction

Figure 1: Recombinant human Thymidine Phosphorylase part

The CALIPSO part (BBa_K4768003) consists of the human Thymidine Phosphorylase (tymp) gene, optimized for expression in E. coli. This part encodes the human thymidine phosphorylase (Typh) enzyme, which can convert Tegafur into 5-Fluorouracil.

Construction

The cDNA of the tymp gene was taken from the Uniprot database and sequence-optimized for expression in E. coli using IDT (Integrated DNA Technologies) tools. The tymp gene was inserted downstream a T7 promoter with an operator site known as dhdO. The synthesis of the gBlock corresponding to this part was performed by IDT. Finally, the gBlock was cloned into the pET21a (+) plasmid and introduced into Stellar competent cells.

We cloned the gBlock in pET21 by using the following primers (from 5' to 3'):

T7-term-F : AGTTCCTCCTTTCAGCAAAAAACCCCTCAAGACC

T7-prom-R : GAGATCTCGATCCCGCGAAATTAATACGACTCACTATAGG

Figure 2: Figure 2: Construction of the plasmid pET21_tymp. (A) Agarose gel electrophoresis of the PCR products generated from the gBlock and pET21 plasmid. 0.8% agarose and EtBr staining were used. (B) Positive clones were identified from the colony PCR screening. T+ and T- refer to positive control (gBlock amplification) and negative control (without DNA matrix), respectively. (C) Double and single-enzymatic digestion of the pET21_tymp derived from clone 4 by EcoRV and BamHI (Simulated (left) and experimental (right) patterns).

Cloning was successful and two plasmids from positive clones (10 and 21) were sent to Eurofins Genomics to check the insert sequence and flanking regions by Sanger sequencing. The correct sequence was obtained with no mutation.

Characterisation

We attempted to produce Typh enzyme in PURE system from the isolated plasmids and also PCR product of the part. Unfortunately, SDS-PAGE analysis of the expression products did not reveal a band of the size of the Thymidine phosphorylase protein (fig. 3).

Figure 2: Figure 3: Figure 3: SDS-page migration (Mini-PROTEAN TGX Stain-free Gels) and Overlay of the green lys revelation and stain free revelation. negative control without DNA (lane 1), DHFR used as positive control is visible at 18 kDa (lane 2), PCR product of Thymidine phosphorylase Typh visible at 52 kDa (lane 3),PCR product of sfgfp visible at 26 kDa and PCR product of nb anti-HER2 visible at 17 kDa (lane 5). The protein marker is in lane 6.

Conclusion and Perspectives

Given the absence of literature data about the production of the human Typh enzyme in a bacterial system, and the difficulty we faced in obtaining from the authors the Tymp gene reported in the article [1], we opted to use the E. coli pyrimidine/purine nucleoside phosphorylase sequence. This gene has already been used in the literature and the sequence was provided to us by the authors [2].

The construction and the expression in PURE system of this part BBa_K4768003 can be performed in the BSL1 laboratory.

References

1. ^[1]Karamitros, C. S., Somody, C. M., Agnello, G., & Rowlinson, S. (2021). Engineering of the Recombinant Expression and PEGylation Efficiency of the Therapeutic Enzyme Human Thymidine Phosphorylase. Frontiers in Bioengineering and Biotechnology, 9.
2. ^[2] Wen, Y., Li, X., Guo, W., & Wu, B. (2022). Crystal structures of a new class of pyrimidine/purine nucleoside phosphorylase revealed a Cupin fold. Proteins: Structure, Function, and Bioinformatics, 90(6), 1233–1241.