Part:BBa_K4447001

EryK coding sequence

Erythromycin C-12 hydroxylase coding sequence from Saccharopolyspora erythraea. The enzyme is responsible for the stereospecific hydroxylation of the macrolactone ring present in erythromycin D and erythromycin B.

---

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  INCOMPATIBLE WITH RFC[21]

  Illegal XhoI site found at 1197
  
• 23
  COMPATIBLE WITH RFC[23]
• 25
  COMPATIBLE WITH RFC[25]
• 1000
  COMPATIBLE WITH RFC[1000]

Usage and Biology

In the last few years, much attention has been drawn to emerging contaminants due to their severe effects on human health and the lack of information about them. Among them, erythromycin has risen as a potential threat in developing antimicrobial resistance. Being capable of detecting this component and its variations in water bodies can lead to the creation of measurement methods capable of degrading them.

In our project, erythromycin C-12 hydroxylase (EC 1.14.13.154) is used as a detector for the presence of erythromycin by catalyzing the oxidation of two stereoisomers of erythromycin, erythromycin B and D to erythromycin C. As shown in Figure 1, this reaction requires NADPH as a reagent and, therefore, gives NADP+ as a reaction product. Consequently, it is possible to evaluate the presence of erythromycin through a coupled reaction employing a NADP+/NADPH colorimetric assay.

Figure 1. Chemical reaction for erythromycin C-12 hydroxylase (EryK).

Erythromycin C-12 hydroxylase, as pictured below in Figure 2, is a monomer with 397 amino acids in length and 43.8 kDa in weight. According to Savino et al. (2009), it binds one heme b(iron(II)-protoporphyrin IX) group per subunit as a cofactor. Lambalot et al. (1995) reported a Michaelis constant of 8 μM for erythromycin D, concluding that it shows a 1200-1900-fold preference for erythromycin D over the alternative substrate erythromycin B. This enzyme participates in various molecular and biological processes, ranging from macrolide biosynthetic processes to oxidoreductase reactions.

File:EryK TecmonterreyGDL.gif

Figure 2. Three-dimensional structure of EryK.

Characterization

PCR amplification from BBa_K4447004

Figure 3. Amplification of EryK through end-point PCR. Lane 1 represents 1kb DNA Ladder from Promega. Lane 2 represents end-point PCR for EryK.

Originally, BBa_K4447001 was located in our FRET expression system (BBa_K4447004). For instance, it had to be amplified through end-point PCR. Primers for amplification are shown below:

• Forward primer: 5' - CGTACCATGGCCGACGAAACCGC - 3'
• Reverse primer: 5' - TAGCGAATTCCTAATGATGATGATGATGATGCGCCGACTGCCTCGGCG - 3'

Forward primer contains a restriction site for the NcoI restriction enzyme, while reverse primer contains a gly-gly-ser spacer, a polyhistidine tag, a stop codon, and a restriction site for the EcoRI restriction enzyme. PCR conditions are shown in Table 1.

Table 1. EryK amplification conditions.

Reactive	Quantity
Nuclease-free water	26 µL
5X Phusion GC Buffer	10 µL
10 mM dNTPs	1 µL
0.5 µM forward primer	5 µL
0.5 µM reverse primer	5 µL
Template DNA (50 ng/µL)	1 µL
DMSO	1.5 µL
Phusion High-Fidelity DNA polymerase	0.5 µL

Finally, results from the PCR are shown in Figure 3. After successfully purifying the fragment from an agarose gel, the concentration obtained was 96.5 ng/µL in 40 µL dilution. With the fragment already purified, we proceeded to perform a restriction digest with the fragment and pBAD/Myc-HisB.

Restriction Enzyme Digestion and Ligation

Figure 4. Restriction Enzyme Digestion of BBa_K4447001 and vector. Lane 1 represents 1kb DNA Ladder from Promega. Lane 2 represents enzyme digestion of BBa_K4447001 with NcoI and EcoRI. Lane 3 represents enzyme digestion of pBAD/Myc-HisB.

We performed a restriction enzyme digestion with EryK already purified and the vector defined. Our digestion involved using NcoI and EcoRI restriction enzymes. For both vector and insert, DNA concentration was stated as 4000 nanograms. Table 2 displays the protocol followed for a 50 µL reaction.

Table 2. Restriction digest conditions.

Reactive	Quantity
Nuclease-free water	add to 50 µL
rCutSmart Buffer	5 µL
Template DNA (up to 4000 ng)	X µL
NcoI restriction enzyme	1 µL
EcoRI restriction enzyme	1 µL

With the DNA fragments purified from an agarose gel, we performed ligation at a molar ratio of 1:5 for vector and insert, as shown in Figure 5. The total vector concentration was 100 nanograms, whereas the reaction volume was 20 µL. Next, Table 2 displays the protocol followed for the reaction.

Figure 5. Escherichia coli TOP10 colonies transformed with BBa_K4447004 cloned in pBAD/Myc-HisB. Bacteria were grown in LB medium with carbenicillin.

Table 2. DNA ligation conditions.

Reactive	Quantity
T4 DNA Ligase Buffer (10X)	2 µL
Vector DNA	100 ng
Insert DNA	773.5 ng
Nuclease-free water	up to 20 µL
T4 DNA Ligase	1.5 µL

References

[1]. Lambalot, R. H., Cane, D. E., Aparicio, J. J., & Katz, L. (1995). Overproduction and characterization of the erythromycin C-12 hydroxylase, EryK. Biochemistry, 34(6), 1858–1866. https://doi.org/10.1021/bi00006a006

[2]. Mirdita, M., Schütze, K., Moriwaki, Y. et al.(2022). ColabFold: making protein folding accessible to all. Nat Methods 19, 679–682. https://doi.org/10.1038/s41592-022-01488-1

[3]. Savino, C., Montemiglio, L. C., Sciara, G., Miele, A. E., Kendrew, S. G., Jemth, P., Gianni, S., & Vallone, B. (2009). Investigating the structural plasticity of a cytochrome P450: three-dimensional structures of P450 EryK and binding to its physiological substrate. The Journal of biological chemistry, 284(42), 29170–29179. https://doi.org/10.1074/jbc.M109.003590

[4]. Stassi, D., Donadio, S., Staver, M. J., & Katz, L. (1993). Identification of a Saccharopolyspora erythraea gene required for the final hydroxylation step in erythromycin biosynthesis. Journal of bacteriology, 175(1), 182–189. https://doi.org/10.1128/jb.175.1.182-189.1993