Part:BBa_K4247024:Design
orf438-tyrosinase operon
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 37
Illegal NotI site found at 76 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 896
Illegal AgeI site found at 798 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 1138
Design Notes
We produced this part as a component of the composite part BBa_K4247024, the orf438-tyrosinase operon. The products of this operon enables the host to perform PTMs on the tyrosine residues in vivo. To do so, we placed orf438 after a common E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA), followed by TATACAT, a small sequence and then, a 6-His Tag (ATGCGGGGTTCT). After the 6-His Tag, we placed a glycine residue, followed by the original Orf438 coding sequence.
Since in the organism S. antibioticus, the orf438 and tyrosinase are placed in an operon, we decided to place a spacer (AAGCACTAATAAT) after the end of the orf438 coding sequence, and then repeat the E.coli RBS (TTTGTTTAACTTTAAGAAGGAGA). After few a small sequence (TTATCTG), the tyrosinase coding sequence begins. The tyrosinase coding sequence is followed by another 6-His Tag. The plasmid construction can be seen in the image below.
In our system we placed first the orf438 and then the tyrosinase sequence, to better simulate the results found by Barnan et al., 1985. However, Choi et al., 2012 placed the orf438 after the tyrosinase gene.
The protein we were co-expressing, mfp151, was placed in pET24(+) and we therefore, used pRSETa plasmid for expressing the orf438-tyrosinase operon so that the 2 plasmids have different ori and selection markers - Kan for pET24(+) and Amp for pRSETa. The plasmids were induced by using 0.1-0.2 mM IPTG.
Source
The sequence of this composite part is obtained from the following basic parts: BBa_K4247022 (Orf438 - Tyrosinase cofactor) and BBa_K4247023 (Tyrosinase).
References
Choi et al.:In vivo modification of tyrosine residues in recombinant mussel adhesive protein by tyrosinase co-expression in Escherichia coli. Microbial Cell Factories, 2012 11:139.
Bernan V, Filpula D, Herber W, Bibb M, Katz E. The nucleotide sequence of the tyrosinase gene from Streptomyces antibioticus and characterization of the gene product. Gene. 1985;37(1-3):101-10. doi: 10.1016/0378-1119(85)90262-8. PMID: 3932128.