Coding
Part:BBa_K4169029:Design
Designed by: Sijia Xu Group: iGEM22_HZAU-China (2022-10-11)
Mutated TMADH
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 388
Illegal PstI site found at 183
Illegal PstI site found at 1782 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 388
Illegal PstI site found at 183
Illegal PstI site found at 1782 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 388
Illegal XhoI site found at 1717 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 388
Illegal PstI site found at 183
Illegal PstI site found at 1782 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 388
Illegal PstI site found at 183
Illegal PstI site found at 1782
Illegal AgeI site found at 879 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
GenScript synthesised tmd plasmids and performed codon optimization. We added His tag on the end of tmd sequence. Then optimized trimethylamine dehydrogenase, mutated amino acid 344 form Val to Cys.The primers we designed for mutation are showned below:
V344C-F: GACGACATCCGTTGTTGTATCGGCTG V344C-R: CAGCCGATACAACAACGGATGTCGTC
Source
111