Coding

Part:BBa_K4221016

Designed by: Chenzhang Ma   Group: iGEM22_BJEA_China   (2022-09-27)
Revision as of 16:03, 10 October 2022 by Chenzhang (Talk | contribs) (Usage)


mOrange-TEVlinker-BslA(42-181aa)

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 43
    Illegal SpeI site found at 619
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 43
    Illegal SpeI site found at 619
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 43
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 43
    Illegal SpeI site found at 619
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 43
    Illegal SpeI site found at 619
  • 1000
    COMPATIBLE WITH RFC[1000]


Usage

Aqueous two-phase separation (ATPS) is a liquid-liquid fractionation technique effectively used for protein separation and purification[1]. When a protein fuses with a hydrophobin, the hydrophobin changes the hydrophobicity of the protein, which causes the protein to aggregate into the surfactants.

Our team is trying to improve traditional ATPS by incorporating a continuous-flow system and replacing fungal hydrophobins with BslA. Using mOrange[2] as target protein can visually observe fluorescent protein (mHoneydew,target protein) showing orange fluorescence in the process of protein expression and two-phase extraction, so as to determine the separation and purification effect.

In the process of protein purification by ATPs, we can use the amphiphilicity of BslA to change the hydrophilicity of fluorescent protein, so that fluorescent protein can only show fluorescence in the organic phase/aqueous phase, so as to achieve a high-efficiency and low-cost protein purification method.

Biology

Conventional Orange FPs are mainly derived from two parental proteins: Kusabira-Orange (KO) and DsRed. KO was originally isolated from stony coral Fungiaconcinna, which provides bright orange fluorescence to proteins by introducing 10 amino acid residues at its N terminus. Shaner et al. improved mHoneydew and mOrange on the basis of mRFP1, a single molecule variant of DsRed.[3]

BslA is a structurally defined bacterial hydrophobin that was found in the biofilm of Bacillus subtilis. It helps the assembling of TasA (an exopolysaccharide and an amyloid fiber-forming protein), the component of the biofilm matrix. BslA is composed of an Ig-type fold with the addition of an unusual, extremely hydrophobic “cap” region. The central hydrophobic residues of the cap are essential to allow a hydrophobic, nonwetting biofilm to form as they control the surface activity of the BslA protein.[4]

Design Consideration

The construct was cloned into a PET28a plasmid and transformed into mOrange-PET28a [2] The construction includes: mOrange is fused with BslA with a TEVlinker(GAAAACCTGTACTTCCAGGGTTCTGGT)

Protein Expression

Figure-6 a .png
Figure 1.

(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into BL21 expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-6 b .png

Figure 1.

(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,

Figure-7 a .png
Figure 2.

(a) SDS-PAGE of pET28a-mOrange-GSlinker-BsIA transformed into Rosetta expressing strains. Induction time: 12h M: GoldBand Plus 3-color Regular Range Protein Marker(8-180 kDa), 1,3,5,7,9,11: Before induction 2,4,6,8,10,12: After induction; 2: 37℃ 0.1mM IPTG,4: 16℃ 0.1mM IPTG,6: 37℃ 0.3mM IPTG,8: 16℃ 0.3mM IPTG,10: 37℃ 0.5mM IPTG,12: 16℃ 0.5mM IPTG

Figure-7 b .png

Figure 2.

(b) 1: 37℃ Before induction 2-4: After induction; 2: 37℃ 0.1mM IPTG, 3: 37℃ 0.3mM IPTG, 4: 37℃ 0.5mM IPTG, 5-7: 16℃ Before induction 8-10: After induction; 8: 16℃ 0.1mM IPTG, 9: 16℃ 0.3mM IPTG, 10: 16℃ 0.5mM IPTG,

Detection of fusion protein function

After the cells of the recombinant strains were induced, centrifuged, and sonicated, the soluble proteins expressed by the strains were all in the supernatant, We used a comparative experiment to add different droplets to the hydrophobic material and observe the water contact Angle.

Figure-8 .png
Figure 3.Water contact angle.

Aqueous two-phase separation (ATPS) Testing

We used 1×PBS as a blank control, we added isobutanol to the protein supernatant, shaken and let stand for a few minutes until the two phases were clearly separated.

Figure-9 b .png
Figure 4. ATPS testing.

Reference

[1] E Mustalahti, M Saloheimo, J J. JoensuuIntracellular protein production in Trichodermareesei (Hypocreajecorina) with hydrophobin fusion technology[J]. New Biotechnology, 2013(30)

[2]Aijia J, Xibin N. Construction and Expression of Prokaryotic Expression Vector pET28a-EGFP[J]. JOURNAL OF MICROBIOLOGY, 2011, 31(4):69-73.

[3]Peng W, He P, Shi D, etal. Advances in the research and applications of orange fluorescent protein[J]. Journal of Biotechnology, 2020, 36(6):1060−1068.

[4]: “BslA is a self-assembling bacterial hydrophobin that coats the Bacillus subtilis biofilm.” Proceedings of the National Academy of Sciences of the United States of America vol. 110,33 (2013): 13600-5. doi:10.1073/pnas.1306390110


[edit]
Categories
Parameters
None