Part:BBa_K4197007

Ana o 3 expression at the surface of E. coli cells sortable by FACS using mRFP1

OmpA_ana o 3 fusion to display cashew allergen.

Introduction

This part is composed of the gene coding for the allergen of cashew Ana o 3 (NCBI: AAL91665.1). The cashew allergy prevalence is higher than 0.08% (Van der Valk and al. 2014) in the US countries and Ana o 3 binds specific antibodies of 100% of the patients with cashew allergy (Sato and al. 2019). Ana o 3 have already been expressed in E. coli and was able to bind the IgE of patient with cashew allergie (Robotham and al. 2005).Ana o 3 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Ana o 3 on the surface of E. coli . This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

Ana o 3 gene ordered on IDT (shown above in Figure 12) was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Ana o 3 (cctgtattttcagagcatggcgaaatttcttttattattg). Expected size of the amplicon was 479 bp.

Amplification product sizes were checked on EtBr stained agarose gel (Figure 13).

Figure 13: Ana o 3 amplified fragment. Expected size of the amplicons was 479 bp. PCR amplicon sizes Ana o 3 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).