Coding

Part:BBa_K4197005

Designed by: Guillaume Gomez   Group: iGEM22_Toulouse_INSA-UPS   (2022-09-22)
Revision as of 22:06, 8 October 2022 by RaphaelFruchard (Talk | contribs)


Gal d 2 expression at the surface of E. coli cells sortable by FACS using mRFP1

Introduction

The part expressing the gene of The part expressing the gene of hen’s egg Gal d 2 (K4197009) has been completed with the ihfb800-RFP construction (K41970012) to express red fluorescence. This red fluorescence allows sorting of bacteria by FACS.

Construction

The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R (cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Gal d 2 (K4197009) by In-Fusion.

The resulting products were transformed into Stellar cells and transformants were selected. Colonies were screened by PCR using screening_insert_R (ccgaaacaagcgctcatgagc) and screening_insert_F (ggttatgctagttattgctcagc) primers. The expected sizes of amplicons was 3688 bp with RFP and 2096 bp without.

Figure 1: Verification of the insertion of RFP fragment in Gal d 2 with gel. The PCR screening was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). Colonies 9, 10 and 11present the correct size for Gal d 2.

Validation

Successful colonies were further tested by digestion with NotI which cut both in the plasmid and in the mRFP1 gene (Figure 2). Correct sizes were expected to be 1922 and 6791 bp for Gal d 2.

Figure 2: Digestion by NotI of Gal d 2 with mRFP1 insertion. The digestion product was checked with 0.6% agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel). colonies 7 and 13 present the correct size for Gal d 2.

This construction has not shown red fluorescence on the microscope. After sequencing, a mutation has been revealed on the mRFP sequence which does not allow us to continue further with this construction.

References

  1. K4197009
  2. K4197012
  3. DAISY (INSA-UPS 2022)

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal NheI site found at 1703
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal NotI site found at 1519
    Illegal NotI site found at 2697
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal BglII site found at 1592
    Illegal BamHI site found at 1735
    Illegal XhoI site found at 2706
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1527
    Illegal EcoRI site found at 1741
    Illegal XbaI site found at 1512
    Illegal XbaI site found at 1658
    Illegal PstI site found at 213
    Illegal PstI site found at 224
    Illegal PstI site found at 342
    Illegal AgeI site found at 329
    Illegal AgeI site found at 1360
    Illegal AgeI site found at 1472
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 2368


[edit]
Categories
Parameters
None