Part:BBa_K4197004
Ara h 2 expression at the surface of E. coli cells sortable by FACS using mRFP1
Brick expressing Ara h 2 at the surface of E. coli cell sortable by FACS
Introduction
The mRFP1 fluorescent reporter has been added on the plasmid allowing to express the gene of arachid Ara h 2 (K4197008) on the surface of E. coli. Expression of mRFP1 is driven by the ihfb800 promoter (see K41970012). This red fluorescence is destined to identify the allergen expressing cells by FACS.
Construction
The ihfb800-mRFP1 construction was amplified by PCR with the high-fidelity Phusion polymerase using BFP/RFP IF+BglII R site R (cgcgggatcgagatctatcacgaggcagaatttcagat) and BFP/RFP IF+BglII R site F (tagaggatcgagatctctgaaacagtgcaaagctaaccc) primers. The expected size of the amplicon is 1622 bp. The fragment was inserted on the linearized plasmid pET21b(+) with Ara h 2 (K4197008) by In-Fusion.
The resulting products were transformed into Stellar cells and transformants were selected. Colonies were screened by PCR using screening_insert_R (ccgaaacaagcgctcatgagc) and screening_insert_F (ggttatgctagttattgctcagc) primers. The expected sizes of amplicons was 3046 bp with RFP and 1454 bp without.
Successful colonies were further tested by digestion with NotI which cut both in the plasmid and in the mRFP1 gene (Figure 2). Correct sizes were expected to be 1280 and 6791 bp for Ara h 2.
Validation
This construction has not shown red fluorescence on the microscope. After sequencing, a mutation has been revealed on the mRFP1 sequence which does not allow us to continue further with this construction.
DAISY Project
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal NheI site found at 1703
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal NotI site found at 1519
Illegal NotI site found at 2697 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal BglII site found at 1592
Illegal BamHI site found at 1735
Illegal XhoI site found at 2706 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1527
Illegal EcoRI site found at 1741
Illegal XbaI site found at 1512
Illegal XbaI site found at 1658
Illegal PstI site found at 213
Illegal PstI site found at 224
Illegal PstI site found at 342
Illegal AgeI site found at 329
Illegal AgeI site found at 1360
Illegal AgeI site found at 1472 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 2368
None |