Coding

Part:BBa_K4197010

Designed by: Guillaume Gomez   Group: iGEM22_Toulouse_INSA-UPS   (2022-09-22)
Revision as of 19:09, 8 October 2022 by Charline baraban (Talk | contribs)


_NOTOC__ OmpA_DARPin_sfGFP fusion

Gene fusion to express the DARPin-sfGFP fusion protein at the surface of E.coli.

Introduction

This part is composed of the gene coding for the DARPin E2_79 protein. This synthetic protein has a strong affinity for the constant part of IgE (Baumann et al., 2010). It was linked to a sfGFP protein. This was merged to the membrane protein OmpA of E. coli (BBa_K1694002) to display the DARPin on the surface of E. coli. This lipoprotein is the most abundant in yhe membrane of E. coli with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016). The fusion protein is described in Part: BBa_K4197011. The sfGFP will be used as a reporter to prove that the fusion protein is expressed at the surface of the membrane. h

Construction

The fusion protein OmpA_DARPin_sfGFP was expressed in the pET-21 b (+) plasmid. As explained in Part BBa_K4197011, two versions of the fusion protein were built, as the first one presented a missing DNA fragment (more details in the corresponding part). OmpA_DARPin-sfGFP fragment from IDT was amplified by PCR using the high fidelity Phusion DNA polymerase with primers FORWARD: gccgcaagctttaatgatggtgatggtgatggtgatg and REVERSE: cgagctccgtcgacaaggaggtaatatacatatgaaagcc. The expected size of the amplicon was 1468 bp (Figure 1).

Figure 1: OmpA_DARPin-sfGFP fragment amplified by PCR. The expected size of the amplicon was 1468 bp. The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gel. (note that a different ladder is presented on the theoretical gel).
The DARPin-sfGFP construction was then inserted into our linearized pET-21 b (+) by In-Fusion to assemble the pET-21 b (+)_OmpA_DARPin-sfGFP plasmid. The In-Fusion mixture was first transformed into chemically competent E. coli Stellar cells. Transformants were selected on LB-ampicillin plates. Resulting colonies were checked by a colony PCR using the primers FORWARD: ggttatgctagttattgctcagc and REVERSE: ccgaaacaagcgctcatgagc. Expected size of positive colonies was 1885 bp (Figure 2) Plasmids colonies containing the insert were extracted by Miniprep.
Figure 2: identifying strains that bear pET-21 b (+)_Ompa_DARPin-sfGFP by colony PCR. The expected size of the amplicon was 1885 bp. The positive clones were colonies 13, 14, 15 and 16. The PCR amplicon size was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the left and the NEB 1 kb DNA ladder was employed for the experimental gels (note that a different ladder is presented on the theoretical gel).
Finally, the pET-21 b (+)_OmpA_DARPin_sfGFP plasmid was used to transform E. coli Tuner (DE3) cells. The expression of the OmpA_DARPin-sfGFP encoding gene in E. coli Tuner cells was induced with a concentration of 50 µM of IPTG. The empty pET-21 b (+) plasmid was used as a negative control. After 4 hours of incubation at 37°C, fluorescence was observed on an epifluorescence microscope as shown on Figure 3.
Figure 3: fluorescence of E. coli Tuner cells containing the pET-21 b (+)_OmpA_DARPin-sfGFP vector (A) or the empty pET-21 b (+) plasmid (B) as a negative control. Each image represents an observation in phase contrast (on the left) and in the GFP fluorescence channel (microscope parameters for GFP).
Some fluorescence emission was clearly observed with pET-21 b (+)_OmpA_DARPin-sfGFP whereas none was seen with the empty plasmid. This suggests that the construction indeed allowed expressing the OmpA_DARPin-sfGFP fusion. The fluorescence seemed to be localized in the cytoplasm as it colored the entire cell. However, the resolution of the microscope could not allow us to determine if the membrane was fluorescent as well. To determine where the OmpA_DARPin-sfGFP fusion proteins were situated in the E. coli Tuner cells, a fractionation protocol that allowed the separation of the different parts of the cells (cytoplasm and periplasm versus membrane) was designed. Briefly, after induction with 25 µM of IPTG at 37°C, sonication was used to break up the cells, resuspension in separating buffers and differential centrifugation steps . The fluorescence emission from each fraction on a microplate reader was then measured. A strain with an empty plasmid was induced at 50 µM of IPTG as a negative control. Curves of fluorescence depending on the dilution factor were established as shown on Figure 4.
Figure 4: fluorescence of the cytoplasm/periplasm and membrane fractions. The negative control (empty plasmid induced at 50 µM of IPTG) is represented in blue and the actual assay (construction induced at 25 µM of IPTG) in orange. The excitation wavelength of the microplate reader was 485 nm. Emission was observed at a wavelength of 528 nm.
As expected, the control fractions were considerably less fluorescent than the samples (approximately a hundred times). This indicates that the OmpA_DARPin-sfGFP fusion protein was present in both the cytoplasm and surrounding membranes. The fluorescence in the membranes was twice lower than in the cytoplasm. The conclusion was that the protein was mainly present in the cytoplasm, but also in the membranes as wanted. A hypothesized was made: the pET-21 b (+)_OmpA_DARPin-sfGFP plasmid led to too high expression levels, leading to saturation of the membrane and expression in the cytoplasm as well. Even if the presence of at least some OmpA_DARPin-sfGFP protein in the membrane fraction was confirmed, the exposition of the protein at the very surface of the bacteria or inside the membrane (facing inwards) was unclear. Another experiment to investigate this last point was conducted. To make sure that the OmpA_DARPin-sfGFP was exposed at the surface of the cells and to quantify more precisely the fluorescence emission from each fraction, the experiment was later on repeated with the addition of a TEV treatment after breaking the cells. The TEV protease should allow releasing the DARPin-sfGFP fusion from OmpA, meaning that after the TEV treatment the fluorescence emission from the membrane fraction should decrease (Figure 5). This time again an empty vector control was included.
Figure 5: fluorescence of the cytoplasm/periplasm and membrane fractions. The negative control (empty plasmid induced at 50 µM of IPTG) is represented in blue and the assay (construction induced at 25 µM of IPTG) in orange. Each fraction was treated with TEV protease and compared with a non-treated sample. The excitation wavelength of the microplate reader was 485 nm. Emission was observed at a wavelength of 528 nm.

Xxxxxxxxx

Xxxxxxxxxxxxx

Figure 2: Xxxxxxxxxxxxx Xxxxxxxxxxxxx.

titre 2

Titre 3

Xxxxxxxxxx

  • Forward : TAAGAAGGAGATATACCATGGCGGAAGCGGGTATCACC
  • Reverse : CTCGAGTGCGGCCGCAAGCTTCGGATCGTCCTATGATGGAGG

Xxxxxxxxxx

  • CForward : CGCGGCCGCTTCTAGAGCGGAAGCGGGTATCACC
  • Reverse : AGCGGCCGCTACTAGTCGGATCGTCCTATGATGGAGG

titre 3

Titre 4

Xxxxxx

Titre 4

xxxxxxx

Titre 2

Xxxxxx

References

  1. Morag E, Lapidot A, Govorko D, Lamed R, Wilchek M, Bayer EA, Shoham Y: Expression, purification, and characterization of the cellulose-binding domain of the scaffoldin subunit from the cellulosome of Clostridium thermocellum. Applied and Environmental Microbiology 1995, 61:1980-1986.
  2. Nogueira ES, Schleier T, Durrenberger M, Ballmer-Hofer K, Ward TR, Jaussi R: High-level secretion of recombinant full-length streptavidin in Pichia pastoris and its application to enantioselective catalysis. Protein Expr Purif 2014, 93:54-62. DOI: 10.1016/j.pep.2013.10.015.
  3. Young TS, Schultz PG: Beyond the canonical 20 amino acids: expanding the genetic lexicon. J Biol Chem 2010, 285:11039-11044. DOI: 10.1074/jbc.R109.091306.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 130
    Illegal NheI site found at 92
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 130
    Illegal BamHI site found at 124
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
    Illegal AgeI site found at 832
  • 1000
    COMPATIBLE WITH RFC[1000]


[edit]
Categories
Parameters
None