Coding

Part:BBa_K4197006

Designed by: Guillaume Gomez   Group: iGEM22_Toulouse_INSA-UPS   (2022-09-22)
Revision as of 07:09, 8 October 2022 by Brice (Talk | contribs)


OmpA_Der p 1 Fusion

Gene fusion to express the dust mite allergen Der p 1 on the surface of E. coli.

Introduction

This part is composed of the gene coding for the allergen of dust mite Der p 1 (NCBI: U11695.1). The mite allergy prevalence is 20% (Lieberman and al. 2018) in the US and Der p 1 triggers 87% of dust mite allergy (Mueller and al. 2015). Der p 1 have already been expressed in E. coli and was able to bind the IgE of patient with dust mite's allergie (Bussières and al. 2010). Der p 1 was merged to the membrane protein OmpA of E. coli (BBa_K1694002), to display Der p 1 on the surface of E. coli . This lipoprotein is the most abundant in E. coli's membrane with 100,000 copies per cell (Ortiz-Suarez and al. 2016) and is often used to display protein on the surface of bacteria (Yang and al. 2016).

Construction

Der p 1 gene ordered on IDT was amplified by PCR using the high fidelity Phusion polymerase with the primers IF3_allergen (gccgcaagctttaatgatggtgatggtgatggtgatg) F and IF4_Der p 1 (cctgtattttcagagcatgaaaatcgtgctggc). Expected size of the amplicon was 994 bp.

Amplification product sizes were checked on Ethidium bromide stained agarose gel (Figure 1).

Figure 1: Der p 1 amplified fragment. Expected size of the amplicons was 994 bp. PCR amplicon sizes Der p 1 were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

PCR products matched expected sizes and amplicons were further purified from the gel. To merge Der p 1 to OmpA, the gene was inserted in a pET-21 b (+) plasmid containing OmpA merged to Gal d 2, another allergen. The plasmid was linearized, excluding the Gal d 2 fragment by PCR. The primers used were IF1_allergen and IF2_plasmid. Expected size of the amplicon was 5924 bp.

Amplification product sizes were checked on Ethidium bromide stained agarose gel (Figure 2).

Figure 2: pET-21 b (+)_OmpA linearized with Gal d 2 exclusion (A) and Ara h 2 amplified fragment (B). Expected sizes of the amplicons were 5924 bp (A) and 567 bp (B). PCR amplicon sizes of pET-21 b (+)_OmpA (A) and Ara h 2 (B) were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The In-Fusion assemby reaction was transformed into Stellar competent cells. Transformants were selected on LB-ampicillin plates. 15 transformants were screened by colony PCR with primer pairs flanking the insertion zone (screening_inserts-F: ggttatgctagttattgctcagc and screening_inserts-R: ccgaaacaagcgctcatgagc; expected size of the amplicons: 1894 bp)(see Primers List). 12 positive transformants were detected (Figure 3).

Figure 3: identifying strains that bear pET21 b (+)_OmpA_Der p 1 by colony PCR. The expected size of the amplicons was 1894 bp. 12 positive clones were detected. PCR amplicon sizes of colonies with Der p 1 plasmid were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

Four of these transformants (colonies 2, 6, 11 and 13) had their plasmid extracted by Miniprep and digested by SalI (expected size of the fragments: 6 kb and 1 kb) or double-digested by HindIII and EcoRI-HF (expected size of the fragments: 5.5 kb and 1.5 kb) to assess the assembly (Figure 4).

Figure 4: restriction profile of pET-21 b (+)_OmpA_Der p 1 for one of the clones. Enzymes were SalI for the simple digestion (expected sizes of the fragments were 6.0 kb and 1.0 kb) and EcoRI and HindIII for the double digestion (expected sizes of the fragments were 5.5 kb and 1.5 kb). Plasmids were checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented with each gel and the NEB 1 kb DNA ladder is used for the experimental gels (note that a different ladder is presented on the theoretical gel).

The correct restriction maps were obtained for the clones which were further validated by sequencing.

The plasmids were finally used to transform E. coli Tuner cells to express the Ompa_Der p 1 construction at the cell membrane.

Validation

We assessed the functionality of the allergens by binding specific anti-Der p 1 IgE to them, and then binding a fluorescent anti-IgE IgG to the complex. No fluorescence was observed in either case (data not shown). Without a positive control, we could not conclude between an incorrect exposition of the protein (not facing the outer surface), or a mere problem during the experimental setup.

References

More information about the project for which the part was created: DAISY (INSA-UPS 2022)

Other parts to display allergens:
- OmpA_Ara h 2
- OmpA_Ana o 3
- OmpA_Fel d 4

  1. Mueller, G. A.; Randall, T. A.; Glesner, J.; Pedersen, L. C.; Perera, L.; Edwards, L. L.; DeRose, E. F.; Chapman, M. D.; London, R. E.; Pomés, A. (2016). Serological, genomic and structural analyses of the major mite allergen Der p 23. Clinical & Experimental Allergy, 46(2), 365–376. doi:10.1111/cea.12680
  2. Bussières, L., Bordas-Le Floch, V., Bulder, I., Chabre, H., Nony, E., Lautrette, A., Berrouet, C., Nguefeu, Y., Horiot, S., Baron-Bodo, V., Van Overtvelt, L., De Conti, A. M., Schlegel, A., Maguet, N., Mouz, N., Lemoine, P., Batard, T., & Moingeon, P. (2010). Recombinant Fusion Proteins Assembling Der p 1 and Der p 2 Allergens from Dermatophagoides pteronyssinus. International Archives of Allergy and Immunology, 153(2), 141–151. https://doi.org/10.1159/000312631
  3. Ortiz-Suarez, M. L., Samsudin, F., Piggot, T. J., Bond, P. J., & Khalid, S. (2016). Full-Length OmpA : Structure, Function, and Membrane Interactions Predicted by Molecular Dynamics Simulations. Biophysical Journal, 111(8), 1692–1702. https://doi.org/10.1016/j.bpj.2016.09.009
  4. Yang, Chao; Zhao, Qiao; Liu, Zheng; Li, Qiyun; Qiao, Chuanling; Mulchandani, Ashok; et al. (2016): Cell Surface Display of Functional Macromolecule Fusions on Escherichia coli for Development of an Autofluorescent Whole-Cell Biocatalyst. ACS Publications. Journal contribution. https://doi.org/10.1021/es800441t.s001
    5.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 130
    Illegal NheI site found at 92
    Illegal NotI site found at 1632
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 130
    Illegal BamHI site found at 124
    Illegal XhoI site found at 1641
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 130
    Illegal XbaI site found at 47
  • 1000
    COMPATIBLE WITH RFC[1000]