![](https://parts.igem.org/images/partbypart/icon_coding.png)
Part:BBa_K4447001
EryK coding sequence
Erythromycin C-12 hydroxylase coding sequence from Saccharopolyspora erythraea. The enzyme is responsible for the stereospecific hydroxylation of the macrolactone ring present in erythromycin D and erythromycin B.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 1197
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Contents
Usage and Biology
In the last few years, much attention has been drawn to emerging contaminants due to their severe effects on human health and the lack of information about them. Among them, erythromycin has risen as a potential threat in developing antimicrobial resistance. Being capable of detecting this component and its variations in water bodies can lead to the creation of measurement methods capable of degrading them.
In our project, erythromycin C-12 hydroxylase (EC 1.14.13.154) is used as a detector for the presence of erythromycin by catalyzing the oxidation of two stereoisomers of erythromycin, erythromycin B and D to erythromycin C. As shown in Figure 1, this reaction requires NADPH as a reagent and, therefore, gives NADP+ as a reaction product. Consequently, it is possible to evaluate the presence of erythromycin through a coupled reaction employing a NADP+/NADPH colorimetric assay.
Erythromycin C-12 hydroxylase, as pictured below in Figure 2, is a monomer with 397 amino acids in length and 43.8 kDa in weight. According to Savino et al. (2009), it binds one heme b(iron(II)-protoporphyrin IX) group per subunit as a cofactor. Lambalot et al. (1995) reported a Michaelis constant of 8 μM for erythromycin D, concluding that it shows a 1200-1900-fold preference for erythromycin D over the alternative substrate erythromycin B. This enzyme participates in various molecular and biological processes, ranging from macrolide biosynthetic processes to oxidoreductase reactions.
Characterization
PCR amplification from BBa_K4447004
Originally, BBa_K4447001 was located in BBa_K4447004. For instance, it had to be amplified through end-point PCR. Primers for amplification are shown below:
- Forward primer: 5' - CGTACCATGGCCGACGAAACCGC - 3'
- Reverse primer: 5' - TAGCGAATTCCTAATGATGATGATGATGATGCGCCGACTGCCTCGGCG - 3'
Forward primer contains a restriction site for the NcoI restriction enzyme, while reverse primer contains a gly-gly-ser spacer, a polyhistidine tag, a stop codon, and a restriction site for the EcoRI restriction enzyme. PCR conditions are shown in Table 1.
Finally, results from the PCR are shown in Figure 3. After successfully purifying the fragment from an agarose gel, the concentration obtained was 96.5 ng/µL in 40 µL dilution.
References
[1]. Lambalot, R. H., Cane, D. E., Aparicio, J. J., & Katz, L. (1995). Overproduction and characterization of the erythromycin C-12 hydroxylase, EryK. Biochemistry, 34(6), 1858–1866. https://doi.org/10.1021/bi00006a006
[2]. Mirdita, M., Schütze, K., Moriwaki, Y. et al.(2022). ColabFold: making protein folding accessible to all. Nat Methods 19, 679–682. https://doi.org/10.1038/s41592-022-01488-1
[3]. Savino, C., Montemiglio, L. C., Sciara, G., Miele, A. E., Kendrew, S. G., Jemth, P., Gianni, S., & Vallone, B. (2009). Investigating the structural plasticity of a cytochrome P450: three-dimensional structures of P450 EryK and binding to its physiological substrate. The Journal of biological chemistry, 284(42), 29170–29179. https://doi.org/10.1074/jbc.M109.003590
[4]. Stassi, D., Donadio, S., Staver, M. J., & Katz, L. (1993). Identification of a Saccharopolyspora erythraea gene required for the final hydroxylation step in erythromycin biosynthesis. Journal of bacteriology, 175(1), 182–189. https://doi.org/10.1128/jb.175.1.182-189.1993biology | S. erythraea |
protein | EryK |