Part:BBa_K3868096
pTarget-8G
pTarget-8G plasmids contains pj23119 and sgRNA-8G etc, which can target the RBS sequence of T7RNAP for Cas9 expression.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 182
Illegal XbaI site found at 188
Illegal SpeI site found at 73
Illegal PstI site found at 200 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 182
Illegal NheI site found at 7
Illegal NheI site found at 30
Illegal NheI site found at 50
Illegal SpeI site found at 73
Illegal PstI site found at 200 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 182
Illegal BglII site found at 212
Illegal XhoI site found at 236 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 182
Illegal XbaI site found at 188
Illegal SpeI site found at 73
Illegal PstI site found at 200 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 182
Illegal XbaI site found at 188
Illegal SpeI site found at 73
Illegal PstI site found at 200 - 1000COMPATIBLE WITH RFC[1000]
Usage and Biology
To achieve the editing of the RBS sequence using CBE, a tailored RBS sequence of 5'-GGGGGGGG-3' was integrated into the corresponding site of the T7 RNAP, yielding a starting strain of BL21 (DE3)-RBS8G. Here, the CRISPR/Cas9 system was used to construct the BL21 (DE3)-RBS8G strain. The pCas and pTarget plamids was provided by our PI, Xiao-Man Sun. In the genome of BL21 (DE3), the CCGGATTTACTAACTGGAAG was chosen as N20 sequence, and then the pTarget-8G plasmid was successfully constructed based on the pTarget (Fig. 1).
- Fig 1. The Schematic diagram of pCas, pTarget, and the composite part of BBa_K3868095 and BBa_K3868096
Results
By sequencing, the RBS sequence of T7RNAP on the genome was successfully replaced by GGGGGGGG (Fig. 2), which indicated that the starting strain BL21 (DE3)-RBS8G was successfully constructed.
- Fig 2. The sequencing results of the RBS sequence of T7RNAP on the genome in the BL21 (DE3) and BL21 (DE3)-RBS8G strain.
Reference
1. Wang Y, Cheng H, Liu Y, Wen X, Zhang K, Ma Y. In-situ generation of large numbers of genetic combinations for metabolic reprogramming via CRISPR-guided base editing. Nature communications. 2021; 12(1): 1-12.
None |