Part:BBa_K3868095
pCas
pCas plasmid of the Crispr-Cas9 system contains Pcas, Spcas9, paraB, λ-red, paraC and arac etc, which plays a role in cutting DNA double strands.
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1572
Illegal EcoRI site found at 2469
Illegal EcoRI site found at 3978
Illegal PstI site found at 3473
Illegal PstI site found at 3720 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1572
Illegal EcoRI site found at 2469
Illegal EcoRI site found at 3978
Illegal NheI site found at 1331
Illegal PstI site found at 3473
Illegal PstI site found at 3720 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1572
Illegal EcoRI site found at 2469
Illegal EcoRI site found at 3978
Illegal BamHI site found at 2408 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1572
Illegal EcoRI site found at 2469
Illegal EcoRI site found at 3978
Illegal PstI site found at 3473
Illegal PstI site found at 3720 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1572
Illegal EcoRI site found at 2469
Illegal EcoRI site found at 3978
Illegal PstI site found at 3473
Illegal PstI site found at 3720
Illegal AgeI site found at 3900 - 1000COMPATIBLE WITH RFC[1000]
Usage and Biology
To achieve the editing of the RBS sequence using CBE, a tailored RBS sequence of 5'-GGGGGGGG-3' was integrated into the corresponding site of the T7 RNAP, yielding a starting strain of BL21 (DE3)-RBS8G. Here, the CRISPR/Cas9 system was used to construct the BL21 (DE3)-RBS8G strain. The pCas and pTarget plamids was provided by our PI, Xiao-Man Sun. In the genome of BL21 (DE3), the CCGGATTTACTAACTGGAAG was chosen as N20 sequence, and then the pTarget-8G plasmid was successfully constructed based on the pTarget (Fig. 1).
- Fig 1. The Schematic diagram of pCas, pTarget, and the composite part of BBa_K3868095 and BBa_K3868096
Results
By sequencing, the RBS sequence of T7RNAP on the genome was successfully replaced by GGGGGGGG (Fig. 2), which indicated that the starting strain BL21 (DE3)-RBS8G was successfully constructed.
- Fig 2. The sequencing results of the RBS sequence of T7RNAP on the genome in the BL21 (DE3) and BL21 (DE3)-RBS8G strain.
Reference
1. Wang Y, Cheng H, Liu Y, Wen X, Zhang K, Ma Y. In-situ generation of large numbers of genetic combinations for metabolic reprogramming via CRISPR-guided base editing. Nature communications. 2021; 12(1): 1-12.
None |