Part:BBa_K4016023
HA-Trim21-LD3
This composite part is made up of Trim21 and LD3 sequence. Trim21 is the fuction module in our design which lead to the ubiquitination and degradation of the target module.The introduction of LD3 makes it possible to combine with BcL-XL, which link to the GFP nanobody, thus lead to GFP degradation.As designed,the part can be used as a small molecules mediated system with GFP reporter.
Usage and Biology
Bcl-XL and LD3 are used in our project as an “OFF system”, based on their disassociation ability in response to A1155463. We replaced the PRYSPRY structure of truncated trim21 with the Bcl-xL and LD3 protein pair, and attached Trim21 to the end of LD3 to achieve specific degradation of the GFP protein.
Our composite part Part:BBa_K4016023 is a testing part reacting with BBa_K4016024. To test the result of the trim21-BcL-XL-LD3 interaction, if this can work, we can make an “OFF switch” in a system mediated by small molecules.
Figure1. Schematic figure of BBa_K4016023 and BBa_K4016024
Characterization
This part BBa_K4016023 was cloned in pXQ107 plasmid and transfected into HEK293T cell lines using Invitrogen LipofectamineTM 3000.It was validated through four ways: PCR, Sequence, and functional testing.
PCR
The PCR is performed with Green Taq Mix by Vazyme.
F-Prime：5’CTAGCGTTTAAACTTAAGCTTGCCACCATGGAGTACCCCTACGACGTGCCCGACTAC 3’
R-Prime：5’GTGGTGGTGGTGGTGCtcgaGCCGTTCAGCAGCGCCAGCCTG 3’
The PCR protocol is selected based on the Users Manuel. The Electrophoresis was performed on a 1% Agarose gel.
Enzyme Digestion
After the assembly the plasmid was transferred into the Competent E. coli DH5α). After culturing overnight in LB,we minipreped the plasmid for cutting. The cutting procedure was performed with Hind III EcoR I restriction endonuclease bought. The plasmid was cutted in a 20μL system at 37 ℃ for 2 hours. The Electrophoresis was performed on a 1％ Agarose glu.
Sequecing
The plasmid was sequenced correct.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 204
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 161
- 1000COMPATIBLE WITH RFC[1000]
Functional test
This part (BBa_K4016023) was tested together with Part:BBa_K4016024
Method
- 1.Cell transfection
(1)Seed HEK293T cells into 6-well cell culture plates.
(2)Culture for 16 h before transfection
(3)Total plasmid mixes of 800ng per well are mixed thoroughly in DMEM before a polyethylenimine (PEI) solution (1 mg/ml) is added into the plasmid mixture in a ratio of 1:5 (plasmid weight/PEI weight)
(4)The plasmid–PEI mixture is vortexed and incubated at room temperature for 15 min. The mixture is then added into the cells and incubated for at least 6 h.
(5)Cells are then changed into fresh medium and culture for 18 h before subculture.
- 2.Dual luciferase assay
(1)Wash HEK293T cells in 6-well plate with PBS and trypsinize prior to resuspension in fresh complete medium in a 15 ml microcentrifuge tube.
(2)Dispense 100ul of cell suspension (approximately 30000 cells per well) into 96 well plates.
(3)Capture the fluorescent image before apply blue light.(24h after transfection)
(4)Apply the experiment group with blue light stimulus (480nm, stimulate 2 seconds with a 58 second-interval) for 24/48/72 h before sampling and analysis assay. Capture the fluorescent image at 48/72 h respectively
(5)At 96h , add Reporter cell lysates in 96 well plates. (100uL per well)
(6)After extensive lysis, centrifugation at 10000-15000g for 3-5 min. Take the supernatant for assay.
(7)Thaw firefly luciferase assay reagent and Renilla luciferase assay buffer, and bring to room temperature. Renilla luciferase assay substrate (100x) was placed on an ice bath or on an ice box for later use.
(8)Prepare Renilla luciferase assay working solution by adding Renilla luciferase assay substrate (100x) at 1:100 in an amount of 100 µ l per sample.
(9)Switch on the microplate reader, set the assay interval to 2 s and the assay time to 10 s.
(10)Take 20 to 100 ul of each sample for assay
(11)Add 100 ul of firefly luciferase assay reagent, measure the RLU (relative light unit) after mixing. Reporter cell lysate was used as a blank control.
(12)Add 100 ul of Renilla luciferase assay working solution
(13)The RLU value obtained from the Fluc assay was divided by the RLU value obtained from the Rluc assay. The degree of reporter gene activation of interest was compared between different samples according to the ratio obtained.
Result
Reference
[1] Giordano-Attianese, G. et al. A computationally designed chimeric antigen receptor provides a small-molecule safety switch for T-cell therapy. Nat Biotechnol 38, 426–432 (2020).
| None |