Part:BBa_K2323004

Lwa Cas13a under T7 promoter with solubility tag

Uses a T7 promoter and RBS B0034 (BBa_B0034) to express Lwa Cas13a (BBa_K2323000) flanked by a 6x His-Tag to allow purification and a SUMO-tag to improve solubility. This is terminated by a Tphi terminator. The whole coding sequence is also available as BBa_K2323001.

Sequence and Features

Assembly Compatibility:

• 10
  COMPATIBLE WITH RFC[10]
• 12
  COMPATIBLE WITH RFC[12]
• 21
  INCOMPATIBLE WITH RFC[21]

  Unknown
• 23
  INCOMPATIBLE WITH RFC[23]

  Unknown
• 25
  INCOMPATIBLE WITH RFC[25]

  Unknown
• 1000
  INCOMPATIBLE WITH RFC[1000]

  Illegal BsaI.rc site found at 2847
  

Usage and Biology

Cas13a from Leptotrichia wadei (Lwa) is class 2 type VI CRISPR-Cas effector. It is capable of targeting specific ssRNA and cleaving them using its bounded crRNA as guide strand. Unlike other ssRNA CRISPR-Cas effectors, Cas13a is capable of processing the precursor crRNA (pre-crRNA) by itself, cleaving, binding the RNA sequence and then building the Cas13a:crRNA surveillance complex. One characteristic of Cas13a along with other type VI members is its ability to degrade other RNA strands regardless of their sequences, provided the protein has been activated by binding and digesting the target sequence complementary to the crRNA. This "collateral activity" makes Cas13a a powerful biological tool, as unspecific RNA degradation can be triggered on command by providing the target RNA.

Plasmid composition

The Biobrick contains a promoter, RBS B0034 and Lwa-Cas13a with a His-SUMO-Tag, that allows for easy expression and purification. The SUMO-tag increases solubility and can be cleaved off with a SUMO-protease after the affinity purification.

The plasmid map shows pSB1C3-His-SUMO-Cas13a which was cloned by the iGEM team Munich 2017 via Golden Gate cloning. The binding sites of used primers and all other components are annotated.

Cloning, Expression and Purification

Cloning

We ordered Lwa in 2 gblocks from IDT, ready for Golden-Gate-Assembly. We ligated it into the pSB1C3-ccdB by restriction digestion of the backbone and having adequate BsaI sites within the gblocks. We confirmed the cloning by colony-PCR, analytical restriction digest and sequencing at GATC. The colony was stored as a Cryo-stock at -80 °C.

This colony PCR confirmed c5 as a positive colony. We made a overnight culture, isolated the cloned plasmid and checked it via analytical restriction digest. After those positives results we sent the part for sequencing with all the 4 sequencing primers plus VR and VF (see plasmid map above) to get a full read.

Name	5'-3' primers sequences
pseq-Lwa-01	CGTTTTCTGTATGACGGCATCC
pseq-Lwa-02	TCCGGATATGAGCGAACTTAAGA
pseq-Lwa-03	GAGAACCTGAAGATGTTTTA
pseq-Lwa-04	ATCATAGGAAAGCAGTTTG

Expression

As the sequence was ordered codon optimized, we could express it in BL21 star. Expression was done overnight at 16 °C in 2xYT media in the pressence of 1 mM IPTG.

Purification

Ni-NTA-Purification of overexpressed Lwa-Cas13a. Supernatant and Elution 1 were used in the characterisation experiments.

Characterisation

Target dependent activity of Cas13a Lwa

We show below, that Cas13a gets activated upon target binding in a concentration dependent manner. In this case, we detected a fragment of the 16S rRNA of E. coli in a plate reader experiment by using the RNaseAlert system readout. After less than 30 minutes a difference between a target containing sample and the negative control (sample without Cas13a Lwa) is visible for both the purified and the unpurified Cas13a. However, the unpurified Cas13a has a visibly larger activity at low target concentrations, and even shows cleavage at 0 nm target. This is probably attributed to residual RNases that are within the cellular lysis mix. The positive control contained RNAse A, which cleaved all RNAseAlert before the measurment could be started in the plate reader.

• Target dependent activity screen of the purified Cas13a
• 

  Purified Protein (Elution fraction 1, see SDS-PAGE above)

• 

  Unpurified Protein (Supernatant, see SDS-PAGE above)

When plotted against each other, the previously mentioned residual activity becomes even clearer. For this reason we suggest a proper purification of the protein to get reproducible results.

Comparison of purified and unpurified protein

Contribution by Team ZJUT_China_B 2020

Group: Team ZJUT_China_B 2020
Author: Xiaojie Zhou
Summary: We learned from literature that Cas13 protein homologues not only have target dependent activity(characterized by iGEM 2017_Munich) but also have different motif preference upon specific nucleotides and LwaCas13a protein's base preference is poly U/AU.This year,on the basis work of iGEM 2017_Munich, ZJUT_China_B further characterized the base preference of LwaCas13a protein's collateral cleavage,which may be a potential feature to achieving multivirus detecting in one pot.

Methodology

Based on our multivirus detecting goal, we designed four kind fluorescent reporters (Table 1). The linking nucleotide are AC, AU, GA, and UC respectively. The fluorophore are FAM, Cy5, Texas-Red-X and VIC respectively. This enables us detecting the corresponding extention of the cleavage. We added those 4 fluorescent reporters in one detecting pot, and got the following data.

Results

Figure1 The base preference cleavage of LwaCas13 protein upon AC, AU, GA, UC
1. Because our former experiment shows that as the excitation goes on, our fluorescent dyes show a certain degree of photobleaching phenomenon, so we decrease the time of excitation. For details of photobleaching phenomenon,click ZJUT_China_B Model
2. The "negative" is the group that we didn't add target while the "experiment" is the group where we add our target.

Analysis

As shown in Figure 1, the results suggest that LwaCas13a protein could cleave AU and AC oligonucleotide even though there is no target in the detecting system which we called "the leakage acticity of Cas13 protein ". Obviously, the LwaCas13a protein shows more "leakage" upon AC while the leakage upon GA and UC are quite slight. When we added target sequence in the detecting system, the cleavage of AC obviously increased (the RFU increased 2.04 times at 30min) but the background subtracted fluorescence of AU reporter increased in a cliff like manner (the RFU increased 13. 89 times at 30min), which means that when the target was added, the protein's activity to cleave AU was activated significantly. Due to the preference appears only when the target was added, we defined this as the cleavage base preference of LwaCas13a protein, or more specifically, "the activating associated cleavage base preference " of the protein.

Contribution by Team IISER_Kolkata 2021

Group: iGEM21_IISER_Kolkata
Author: Soumi Bhattacharyya, Shubhamay Das
Summary: We learnt that Team iGEM17_Munich has performed the assay for target-dependent activity of purified Cas13a protein under different concentrations of target RNA molecules. Team ZJUT_China_B 2020 has characterized the base preference of collateral cleavage activity of LwaCas13a protein. Due to limitations in laboratory access, we have contributed more information about this part through literature survey.