Part:BBa_K3930026
3,6-nonadienal induction system and expression in S. elongatus (pCONCOMBRE)
Sequence and Features
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 2244
Illegal EcoRI site found at 2250
Illegal XbaI site found at 590
Illegal XbaI site found at 6286
Illegal XbaI site found at 8003
Illegal XbaI site found at 8030
Illegal PstI site found at 8476 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 2244
Illegal EcoRI site found at 2250
Illegal NheI site found at 777
Illegal NheI site found at 872
Illegal NheI site found at 899
Illegal PstI site found at 8476
Illegal NotI site found at 7951
Illegal NotI site found at 7959 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 2244
Illegal EcoRI site found at 2250
Illegal BglII site found at 6283
Illegal BglII site found at 6289
Illegal BamHI site found at 3717
Illegal XhoI site found at 3753
Illegal XhoI site found at 4736
Illegal XhoI site found at 6361 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 2244
Illegal EcoRI site found at 2250
Illegal XbaI site found at 590
Illegal XbaI site found at 6286
Illegal XbaI site found at 8003
Illegal XbaI site found at 8030
Illegal PstI site found at 8476 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 2244
Illegal EcoRI site found at 2250
Illegal XbaI site found at 590
Illegal XbaI site found at 6286
Illegal XbaI site found at 8003
Illegal XbaI site found at 8030
Illegal PstI site found at 8476
Illegal NgoMIV site found at 1936
Illegal AgeI site found at 2163
Illegal AgeI site found at 2190
Illegal AgeI site found at 4955
Illegal AgeI site found at 7844 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 8686
Illegal BsaI.rc site found at 911
Illegal SapI site found at 2653
Illegal SapI site found at 3728
Illegal SapI.rc site found at 7355
Introduction
The pCONCOMBRE part (BBa_K3930026) enables the production of 3,6-nonadienal from linolenic and linoleic acids, and is composed by:
- the RA (BBa_K3930027) and LA (BBa_K3930028) integration sites in the NSI locus of the S.elongatus genome (based on the plasmid pAM4951 from Easyclone Marker free kit (Taton et al. 2014))
- the Nb-9-LOX (BBa_K3930030), Cm-9-HPL (BBa_K3930031) and LacI genes (Part:BBa_C0012), for the production of 3,6-nonadienal and LacI repressor. The sequences of the Nb-9-LOX and the Cm-9-HPL were codon optimized for an expression into S.elongatus
- the inducible promoters Trc-theoE-riboswitch (BBa_K3930029) with IPTG and theophylline, driving the expression of Nb-9-LOX and Cm-9-HPL
- the resistance marker SpecR (BBa_K3930032) to select for Cyanobacteria integrants
Construction
IDT and Twist Bioscience performed the DNA synthesis and delivered the part as gBlock. The construct was cloned with an In-Fusion Takara kit into the pCfB3032 plasmid and then transformed into E.coli Dh5α strain. Figure 1 shows the restriction map of the resulting clones. The expected restriction profile was obtained for clone 3.
pFRAMBOISE restriction profile from clone 3 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)
The plasmid containing the pFRAMBOISE-notfused construct was then linearized with the F and R linearization primers pFRAMBOISE. Then the amplicon was integrated into the genome of our LycoYeast strain with the Takara Yeast transformation protocol. Figure 2 shows the electrophoresis gel of PCR on colony to verify clones.The expected size was obtained for clone D2.
Primer used to clone this part in the pCfB3032:
- pFRAMBOISE_pCfB3032_Forward : 5' acaggcaatactctgcag 3'
- pFRAMBOISE_pCfB3032_Reverse : 5' tctctagaaagtataggaacttcac 3'
pFRAMBOISE-notfused integration from clone D2 was checked with agarose electrophoresis gel and revealed with EtBr. A theoretical gel is presented on the right of each gel and the NEB 1 kb DNA ladder on the left (note that a different ladder is presented on the theoretical gel)
pFRAMBOISE-notfused insert at locus X-3 was successful. The integrant strain was named LycoYeast-pFRAMBOISE-notfused and saved as glycerol stock.
Characterisation
Production of β-ionone
After verifying the correct integration of our constructs by PCR, our engineered LycoYeast strains were placed on YPD plates containing the inducers with the aim to detect color changes due to the conversion of lycopenes (red) to carotenes (orange).
Figure 3 shows the colors of the colonies with or without the inducer, the galactose. The LycoYeast-pFRAMBOISE-notfused strain plated on a YPD with doxycycline Petri dish shows a yellow coloration, indicating the degradation of lycopene into β-carotene.
The carotenoids contained in the cells were extracted using the method described by López et al. (2020). Yeast cells were lysed in acetone using glass beads and the supernatant obtained after this lysis was analyzed by RP-HPLC using a C18 column.In the LycoYeast-pFRAMBOISE-notfused strains, Figure 4 shows that lycopene is converted into a new product with a higher retention time upon induction. Considering the yellow color of pFRAMBOISE-notfused strains, as well as the in-line following β-ionone production results, this new peak most likely corresponds to β-carotene, the expected precursor. Nonetheless, it seems that the negative control from the Teto7 promoter doesn't work when there is no inducer added in the media of culture
The β-ionone is very volatile. A common strategy to avoid losing these molecules during the culture is to grow the engineered microorganisms in a culture medium supplemented with an organic phase to trap the molecules of interest.The most common organic solvent used is dodecane for ionones (Chen et al. 2019; López et al. 2020).Figure 5 shows the GC-MS spectrum for the LycoYeast-FRAMBOISE-notfused strain. A peak can be observed at the same retention time as the β-ionone standard for the induced LycoYeast-FRAMBOISE-notfused strain. The mass spectra associated with this peak matched with the one obtained with the analytical standard. The β-ionone attribution was further confirmed by the NIST mass spectral library (National Institute of Standards and Technology).The production of β-ionone, the main molecule of the violet odour, was successfully achieved with this construction.
Conclusion and Perspectives
These results show that pFRAMBOISE-notfused has the ability to degrade lycopene into β-carotene and futher transform it into the β-ionone. The quantification of β-ionone production remains to be determined under the optimal conditions for the production of the molecule of interest. Moreover a functional Teto7 promoter need to replace the non-functional one.
The β-ionone belongs to the terpene family and may have other uses besides perfumery, notably in medicine. We sincerely thank the future teams that will use this construction and encourage them to contact us for further details.
References
- Chen X, Shukal S, Zhang C. 2019. Integrating Enzyme and Metabolic Engineering Tools for Enhanced α-Ionone Production. J Agric Food Chem. 67(49):13451–13459. doi:10.1021/acs.jafc.9b00860.
- Jessop-Fabre MM, Jakočiūnas T, Stovicek V, Dai Z, Jensen MK, Keasling JD, Borodina I. 2016. EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 11(8):1110–1117. doi:10.1002/biot.201600147.
- López J, Bustos D, Camilo C, Arenas N, Saa PA, Agosin E. 2020. Engineering Saccharomyces cerevisiae for the Overproduction of β-Ionone and Its Precursor β-Carotene. Front Bioeng Biotechnol. 8:578793. doi:10.3389/fbioe.2020.578793.
| None |