Part:BBa_K3416113

F. columnare LFA detection probe (cslA)

Introduction

Vilnius-Lithuania iGEM 2020 project FlavoFlowincludes three goals towards looking for Flavobacterium disease-related problems solutions. The project includes creating a rapid detection kit, based on HDA and LFA, developing an implement for treating a disease, and creating a foundation of edible vaccines. This part was used for the first goal- detection - of the project FlavoFlow.

Overview

Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacterium identification and detection purposes. F. columnare causes bacterial cold water disease in freshwater fish. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.

Detection system

Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.

Bioinformatic analysis

To improve specificity we found out that cslA gene can be used for F. columnare identification¹.We created ssDNA probes for hypothetical protein B0A56_04620 (Flavobacterium columnare, NBRC 100251 = ATCC 23463) because we found it to be homologous to cslA protein sequence. These probes were also designed to have a greater GC% and length to improve hybridization reaction.

To develop the F. columnare LFA test based on cslA gene these parts are needed: BBa_K3416113, BBa_K3416114,BBa_K3416115. Primers to amplify a fragment of cslA are:

F_Colum: AATGACTTCAACTAGAACAGTAGGTGCTGA

R_Colum: TATGAATTGTGTAATTCACTCCTGCCCCT

In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.

Description of cslA F. columnare detection probe

BBa_K3416112 is a detection probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticle. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without thiol group modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle³. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the 5’ end. Also, the probe should contain a poly-A sequence for efficient gold nanoparticles functionalization using a low pH method⁴. The rest of the sequence is left free for hybridization. Thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.

Table 1. | Parameters of detection probe created for nucleic acid lateral flow assay test. Tm and GC% was calculated without poly-A sequence using IDT oligo analyzer tool. (A)20 marks poly-A sequence of 20 adenines. ThioMC6-D - Thiol group modification.

Species	Probe type	Sequence and its modification
F. columnare cslA gene (JX657167.1)	Detection probe	ThioMC6-D-AAAAAAAAAAAAAAAAAAAAACAGTAGGTGCTGAAGCAGG

---

References

1. Strepparava, N., Wahli, T., Segner, H. & Petrini, O. Detection and quantification of Flavobacterium psychrophilum in water and fish tissue samples by quantitative real time PCR. BMC Microbiology, 14, 105 (2014).
2. Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761–2764 (2007).
3. Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Anal. Methods, 9, 2633–2643 (2017).
4. Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. J. Am. Chem. Soc., 134, 7266–7269 (2012).