Part:BBa_K3416101

F. columnare LFA detection probe (16S rRNR)

Description of 16S F. columnare detection probe

Vilnius Lithuania iGEM 2020 team decided to create a lateral flow assay (LFA) test for Flavobacteria identification and detection purposes. F. columnare causes columnaris disease in freshwater fish. The infection results in skin and fin erosions as well as gill necrosis and eventually leads to death¹. It is essential to detect the infection-causing pathogen as soon as possible so that an appropriate treatment could be started. To do this, our team created a helicase dependent amplification (HDA)-LFA based detection test that in a few hours can identify an exact bacteria.

Lateral flow assay based on nucleic acid requires three single-stranded DNA probes: detection, capture, and control. The main principle of this method is that the added ssDNA amplicon hybridizes to the detection probe as well as capture probe, due to this first visible red line appears, eventually a second line also appears due to the hybridization of control and detection probe. If two lines are present, then the test is positive, if only one is visible - negative.

Usually, for phylogenetic analysis and identification 16S rRNA gene can be used². For this reason, we developed LFA probes based on this gene sequence. F. columnare 16S rRNA gene (AY577821) was chosen as a marker sequence. To make sure that the LFA test is highly specific, we made a multiple sequence alignment with 16S rRNA genes from other species within the same genus using Clustal Omega tool (1. 2. 4.). Unique target sequences for F. columnare LFA probes were selected based on the absence of matching alignments between sequences (Fig. 1).

<figure one> <figure description>

To develop the F. columnare LFA test based on 16S rRNA gene these parts are needed: BBa_K3416101, BBa_K3416102,BBa_K3416103. Primers to amplify a fragment of 16S rRNA are: F.Col.16S 5’GGATAGCCCAGAGAAATTTGGA3’ and R.Col.16S 5’CAT CTT GTA CCG TTG GAA CTT TAA T3’. In our case, detection and capture probes were created to be complementary to the negative strand of the gene. All protocols needed to prepare LFA tests as well as to perform HDA can be found in Vilnius-Lithuania iGEM 2020 team wiki page.

BBa_K3416101 is a detection probe used to functionalize gold nanoparticles, meaning that a part of the sequence is adsorbed by gold nanoparticles. This basic part is only the DNA sequence itself, but for successful LFA test development, modifications are needed. Without the thiol group modification detection probe sequence can lose its molecular recognition function after conjugation to gold nanoparticle³. For this reason, a thiol group (ThioMC6-D, IDT) must be added to the 5’ end. Also, the probe should contain a poly-A sequence for efficient gold nanoparticle functionalization using a low pH method⁴. The rest of the sequence is left free for hybridization. The thiol group reacts with gold nanoparticle and allows efficient functionalization reaction.

Table 1. Tm and GC content was determined using Snapgene software. GC count is shown without a poly-A site

BBa_K3416101

Hybridization site: 172-180 bp

thiol-(A)20TTT CAG ATG

TM: 48.2 ºC, GC%:10.3 %, Size: 29 bp

References

1. Declercq, A. M., Haesebrouck, F., Van den Broeck, W., Bossier, P. & Decostere, A. Columnaris disease in fish: a review with emphasis on bacterium-host interactions. Vet Res, 44, 27 (2013).
2. Janda, J. M. & Abbott, S. L. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology, 45, 2761–2764 (2007).
3. Liu, B. & Liu, J. Methods for preparing DNA-functionalized gold nanoparticles, a key reagent of bioanalytical chemistry. Anal. Methods, 9, 2633–2643 (2017).
4. Zhang, X., Servos, M. R. & Liu, J. Instantaneous and Quantitative Functionalization of Gold Nanoparticles with Thiolated DNA Using a pH-Assisted and Surfactant-Free Route. J. Am. Chem. Soc., 134, 7266–7269 (2012).